ID: 1198363176

View in Genome Browser
Species Human (GRCh38)
Location X:135915674-135915696
Sequence CATGTGAGGATACAGCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198363172_1198363176 23 Left 1198363172 X:135915628-135915650 CCTTATAATTAAAGAAAAGAGAA No data
Right 1198363176 X:135915674-135915696 CATGTGAGGATACAGCAAGGTGG No data
1198363173_1198363176 -9 Left 1198363173 X:135915660-135915682 CCATGCTTCTTCAACATGTGAGG No data
Right 1198363176 X:135915674-135915696 CATGTGAGGATACAGCAAGGTGG No data
1198363171_1198363176 24 Left 1198363171 X:135915627-135915649 CCCTTATAATTAAAGAAAAGAGA No data
Right 1198363176 X:135915674-135915696 CATGTGAGGATACAGCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198363176 Original CRISPR CATGTGAGGATACAGCAAGG TGG Intergenic
No off target data available for this crispr