ID: 1198363178

View in Genome Browser
Species Human (GRCh38)
Location X:135915696-135915718
Sequence GCTGACTACAAGTTAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198363173_1198363178 13 Left 1198363173 X:135915660-135915682 CCATGCTTCTTCAACATGTGAGG No data
Right 1198363178 X:135915696-135915718 GCTGACTACAAGTTAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198363178 Original CRISPR GCTGACTACAAGTTAGGAAG AGG Intergenic
No off target data available for this crispr