ID: 1198364732

View in Genome Browser
Species Human (GRCh38)
Location X:135929145-135929167
Sequence AAGAGCTTCTGCTTTAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198364732_1198364741 20 Left 1198364732 X:135929145-135929167 CCTACTTTAAAGCAGAAGCTCTT No data
Right 1198364741 X:135929188-135929210 TTTGGCATGGCAGCAGGGGCAGG No data
1198364732_1198364736 2 Left 1198364732 X:135929145-135929167 CCTACTTTAAAGCAGAAGCTCTT No data
Right 1198364736 X:135929170-135929192 GGGAATCATCAGGTTGTGTTTGG No data
1198364732_1198364737 7 Left 1198364732 X:135929145-135929167 CCTACTTTAAAGCAGAAGCTCTT No data
Right 1198364737 X:135929175-135929197 TCATCAGGTTGTGTTTGGCATGG No data
1198364732_1198364738 14 Left 1198364732 X:135929145-135929167 CCTACTTTAAAGCAGAAGCTCTT No data
Right 1198364738 X:135929182-135929204 GTTGTGTTTGGCATGGCAGCAGG No data
1198364732_1198364739 15 Left 1198364732 X:135929145-135929167 CCTACTTTAAAGCAGAAGCTCTT No data
Right 1198364739 X:135929183-135929205 TTGTGTTTGGCATGGCAGCAGGG No data
1198364732_1198364742 21 Left 1198364732 X:135929145-135929167 CCTACTTTAAAGCAGAAGCTCTT No data
Right 1198364742 X:135929189-135929211 TTGGCATGGCAGCAGGGGCAGGG No data
1198364732_1198364735 -8 Left 1198364732 X:135929145-135929167 CCTACTTTAAAGCAGAAGCTCTT No data
Right 1198364735 X:135929160-135929182 AAGCTCTTTTGGGAATCATCAGG No data
1198364732_1198364740 16 Left 1198364732 X:135929145-135929167 CCTACTTTAAAGCAGAAGCTCTT No data
Right 1198364740 X:135929184-135929206 TGTGTTTGGCATGGCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198364732 Original CRISPR AAGAGCTTCTGCTTTAAAGT AGG (reversed) Intergenic
No off target data available for this crispr