ID: 1198370348

View in Genome Browser
Species Human (GRCh38)
Location X:135983672-135983694
Sequence CTGGTCAGGGAAGCAATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198370342_1198370348 24 Left 1198370342 X:135983625-135983647 CCACATAAACAGAGGTGGAGTCT No data
Right 1198370348 X:135983672-135983694 CTGGTCAGGGAAGCAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198370348 Original CRISPR CTGGTCAGGGAAGCAATCTG TGG Intergenic
No off target data available for this crispr