ID: 1198370718

View in Genome Browser
Species Human (GRCh38)
Location X:135986061-135986083
Sequence CTGGGGGTGCGGAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 409}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198370718_1198370743 28 Left 1198370718 X:135986061-135986083 CCCTTTTTCCTCCGCACCCCCAG 0: 1
1: 0
2: 3
3: 38
4: 409
Right 1198370743 X:135986112-135986134 TCGGGACCCGGGGCTGAGGATGG 0: 1
1: 0
2: 0
3: 20
4: 293
1198370718_1198370737 16 Left 1198370718 X:135986061-135986083 CCCTTTTTCCTCCGCACCCCCAG 0: 1
1: 0
2: 3
3: 38
4: 409
Right 1198370737 X:135986100-135986122 TGCCTACCAAGCTCGGGACCCGG 0: 1
1: 0
2: 0
3: 3
4: 75
1198370718_1198370740 18 Left 1198370718 X:135986061-135986083 CCCTTTTTCCTCCGCACCCCCAG 0: 1
1: 0
2: 3
3: 38
4: 409
Right 1198370740 X:135986102-135986124 CCTACCAAGCTCGGGACCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 42
1198370718_1198370738 17 Left 1198370718 X:135986061-135986083 CCCTTTTTCCTCCGCACCCCCAG 0: 1
1: 0
2: 3
3: 38
4: 409
Right 1198370738 X:135986101-135986123 GCCTACCAAGCTCGGGACCCGGG 0: 1
1: 0
2: 1
3: 12
4: 81
1198370718_1198370733 9 Left 1198370718 X:135986061-135986083 CCCTTTTTCCTCCGCACCCCCAG 0: 1
1: 0
2: 3
3: 38
4: 409
Right 1198370733 X:135986093-135986115 CTTTCCCTGCCTACCAAGCTCGG 0: 1
1: 0
2: 2
3: 20
4: 239
1198370718_1198370742 24 Left 1198370718 X:135986061-135986083 CCCTTTTTCCTCCGCACCCCCAG 0: 1
1: 0
2: 3
3: 38
4: 409
Right 1198370742 X:135986108-135986130 AAGCTCGGGACCCGGGGCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 189
1198370718_1198370734 10 Left 1198370718 X:135986061-135986083 CCCTTTTTCCTCCGCACCCCCAG 0: 1
1: 0
2: 3
3: 38
4: 409
Right 1198370734 X:135986094-135986116 TTTCCCTGCCTACCAAGCTCGGG 0: 1
1: 0
2: 1
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198370718 Original CRISPR CTGGGGGTGCGGAGGAAAAA GGG (reversed) Intronic
900318885 1:2072844-2072866 CTGGGGGTGCAGAGGGACAGAGG - Intronic
900550135 1:3250453-3250475 GTGGGGGGGCGGCGGCAAAAGGG - Intronic
900658269 1:3770792-3770814 CTGGGGGAGGGGAGGAGGAAGGG + Intronic
901301085 1:8200527-8200549 CGGGGAGTGGGGAGGAGAAAGGG + Intergenic
901664807 1:10820088-10820110 CTCAGGGTGAGGAGGAAACAAGG + Intergenic
901857061 1:12051351-12051373 CTGGGGGCCTGGAGGCAAAATGG + Intergenic
901916185 1:12502396-12502418 CTGGGGGTGCTGAAGAGCAAGGG + Intronic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
902879729 1:19363541-19363563 CTGGGGGGAAGGAGAAAAAAGGG + Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
904315366 1:29656548-29656570 TTGGGGGATGGGAGGAAAAAAGG - Intergenic
904841298 1:33373557-33373579 CTGGGGATGGGGAGGATCAAAGG - Intronic
905236568 1:36554190-36554212 CTGTGGGTGCGGAGCAAGCATGG - Intergenic
905871442 1:41406686-41406708 CAGGGGGAGAAGAGGAAAAAGGG - Intergenic
906279602 1:44544070-44544092 CTGGGGATGAGGAGGAAGATGGG - Intronic
906536642 1:46554507-46554529 GTGGGGGTGGGGAGGAACAGTGG + Intergenic
906748101 1:48235611-48235633 CTGGGGGTGGGGATGAGAGAGGG - Intronic
907412159 1:54290441-54290463 CTGGGGATGGGGAGACAAAAAGG + Intronic
907426124 1:54380289-54380311 ATGGGGGTGAGGAGGAACCATGG - Intronic
909339927 1:74520381-74520403 CTGGAGGGGCTGAGGAAGAAAGG - Intronic
909500670 1:76331663-76331685 CTGGAGGTGGTGAGGAAAACAGG - Intronic
910990749 1:93053466-93053488 GTGGGGGAGGGGAGGAAATAAGG - Intergenic
913013966 1:114713979-114714001 CTGGGGGTGTGGAGGGTAAGGGG + Intronic
913217886 1:116635801-116635823 CTGGGTGTGGGGTGGAGAAAAGG - Intronic
914334671 1:146703575-146703597 CTGGTGAGGCAGAGGAAAAAAGG - Intergenic
914874622 1:151503625-151503647 TTGGGTGTGTGGAGGAAAACTGG + Intergenic
915529224 1:156493875-156493897 CTGGGGGTGGGGAGCTAAGAAGG - Intronic
915831962 1:159139774-159139796 CTGGGGATGAGGTGGAAACAGGG - Intronic
915951028 1:160190188-160190210 CTGGGGGAGGGGAGGTATAAGGG - Intergenic
920771717 1:208892787-208892809 CTGGGGGTGGGGAAGAGACAGGG - Intergenic
921219350 1:212962165-212962187 CTGCGGATGCGGAGAAGAAAGGG - Intronic
922160280 1:223074610-223074632 CTGGGGATCCAGAGGAAAAGGGG + Intergenic
922422873 1:225471306-225471328 CTGGGGGTGCGGATGACATGTGG + Intergenic
922769135 1:228172735-228172757 CTGCTGGTGGGGAGGCAAAACGG - Intronic
922894148 1:229087887-229087909 CAGGGAATGCTGAGGAAAAAGGG - Intergenic
923260167 1:232260953-232260975 CTGGGGGAGGGTGGGAAAAAAGG - Intergenic
923448672 1:234096273-234096295 CTGGGAGAGCCGAGGAAAAAGGG - Intronic
924226480 1:241926393-241926415 GTGGGGATGTGGAGGGAAAAAGG - Intergenic
1063025110 10:2170410-2170432 ATGGGGGTGGTGAGGATAAAAGG - Intergenic
1063522861 10:6757036-6757058 GTGGGGGTGTGGAGGGACAAGGG + Intergenic
1064409651 10:15093699-15093721 TAGGGGGTGCGGAGAAAGAAGGG - Intergenic
1064925532 10:20564989-20565011 CTGGGTGGGTGGATGAAAAAAGG + Intergenic
1066689199 10:38010302-38010324 CTTTGGGAGCGGGGGAAAAAAGG - Intergenic
1067025306 10:42838813-42838835 CTGGGGGTTGTGAGGAACAAGGG + Intergenic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1067790676 10:49285056-49285078 CTGCTGGTGGGGATGAAAAATGG + Intergenic
1068218262 10:54010688-54010710 CTTGGGCTGGGGAGGAACAAAGG + Intronic
1069170871 10:65227122-65227144 CTGGGGCTGGGAAAGAAAAAAGG + Intergenic
1069956309 10:72053975-72053997 CTGGGGCTGCGGAGGAGGAGAGG + Intergenic
1070630474 10:78081165-78081187 CTGGGGGGCAGGAGGAAGAATGG + Intergenic
1070794733 10:79210042-79210064 CTGGGGGGGCGGAGGGAGAAGGG - Intronic
1071177072 10:82939245-82939267 GTGGGGGTGCAGGGGAAGAAAGG + Intronic
1071711998 10:88059030-88059052 CTGGGGGCAGGGAGAAAAAAGGG + Intergenic
1071868917 10:89770035-89770057 CTTTGGGTGCAGAGGCAAAATGG - Intronic
1071945235 10:90636266-90636288 CTGGGGGTGAGGAGCTGAAAAGG + Intergenic
1071969793 10:90892483-90892505 CGGGGGGAGGGGAGAAAAAAAGG - Intronic
1071992150 10:91110180-91110202 CTTGGGGTGAGCAGGAAAAAGGG + Intergenic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1073323330 10:102628605-102628627 CTGGGGGAGCAGAGGAAAGTAGG + Intronic
1073510548 10:104039991-104040013 CTGGGGGACCTGAGGGAAAAAGG + Exonic
1073553339 10:104424406-104424428 CTGGAGGTGTGCAGGACAAAAGG - Intronic
1074505822 10:114069590-114069612 CTGGCTCTGGGGAGGAAAAAAGG - Intergenic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1075083807 10:119400826-119400848 TTGGGGATGGGGAGGAACAAAGG + Intronic
1075505886 10:123021830-123021852 CTTGGGGTTCTGAGGAAAACAGG + Intronic
1076669032 10:132109467-132109489 CTGCGGGCGCGCAGGAACAAGGG - Intronic
1077473577 11:2776178-2776200 CTGGGGGTGGTGAGGAGAAGGGG - Intronic
1077479260 11:2805762-2805784 CTGGGGAAGCCGAGGAGAAATGG + Intronic
1078638002 11:13069679-13069701 CAGGGGGTGGGGAGGAAGAAAGG + Intergenic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1081613651 11:44578196-44578218 CTGGGTGTCCAGAGGAAAAGGGG - Intronic
1081864675 11:46352948-46352970 CAGGGGGTGAAGAGGAAAGATGG - Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083893066 11:65606577-65606599 CTGGGGGCGGGGAGGAAGAGGGG + Intronic
1084467044 11:69329715-69329737 ATGGGGGTGGGGAGGAACATGGG - Intronic
1084542082 11:69793072-69793094 CAGGGGGTGCAGAGAAGAAATGG - Intergenic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084763075 11:71286426-71286448 CTGTGGGTGGGGATGTAAAACGG - Intergenic
1085150249 11:74246691-74246713 CTGGGTGTGGGGAGGAGAAAAGG - Intronic
1085446548 11:76604664-76604686 ATGGGGGTGGGAAGGAAAGAGGG - Intergenic
1087109881 11:94453417-94453439 TTGGTGGTGGGGATGAAAAATGG - Intronic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1089433614 11:118443187-118443209 CTGGGAATAGGGAGGAAAAAGGG + Intronic
1089498604 11:118920025-118920047 CTGGGGGTGGGGACGTAAAAGGG + Intronic
1090257205 11:125293134-125293156 CTGGGGGTGGGGTGGACGAATGG + Intronic
1090449420 11:126793093-126793115 GTGGGGGTGGGGAGCTAAAAAGG - Intronic
1091294080 11:134460278-134460300 CTGGGGGTGGGGAGGAACAAAGG + Intergenic
1091342087 11:134823788-134823810 CTGGGGCAGCAGAGGAGAAAAGG - Intergenic
1092654578 12:10671618-10671640 CTGGGGGTCAGAAGTAAAAATGG - Intronic
1092895072 12:13002518-13002540 CTGGCTGTCAGGAGGAAAAAGGG - Intergenic
1093286559 12:17270784-17270806 CTGGTGGTGTGGAAGAGAAATGG - Intergenic
1093841860 12:23912831-23912853 ATGGGGGTGGGGAGGGGAAATGG + Intronic
1093866258 12:24230402-24230424 CTGGGGGAGGGGTAGAAAAACGG + Intergenic
1094766117 12:33596553-33596575 CTGCGGTTGGGGAGGAGAAAGGG + Intergenic
1096085798 12:48864488-48864510 CTGGGGGTGGGCAGTAAAACAGG - Intronic
1096801883 12:54115789-54115811 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1097169585 12:57105340-57105362 CTGGGAGTGAGGAGGACACAAGG + Intronic
1097172678 12:57126366-57126388 CTGAGGGTGCAGCTGAAAAATGG + Intronic
1097706211 12:62870954-62870976 CTGGTGGTGGGAAGGTAAAATGG + Intronic
1098484517 12:71005252-71005274 CATGGGGTGGGGAGGAAATAGGG - Intergenic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1101879839 12:108618657-108618679 CTGGGGGTGCTGATGGAAGAAGG - Intergenic
1102637329 12:114335757-114335779 CTGGGGGAGGGGAGGAAGTAGGG + Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102957007 12:117065291-117065313 CTGGGGGAGCAGAGGAAGAAGGG + Intronic
1104850636 12:131871906-131871928 CAGGGGATGGGGAGGAAAGAAGG + Intergenic
1105578613 13:21674348-21674370 GTGGGGGTGGGGGGGACAAAGGG + Intronic
1105892184 13:24689720-24689742 CTGGGGCTCAGGAGCAAAAATGG - Intronic
1105900150 13:24746311-24746333 GTGGGGGTGCGCAGGGAGAATGG + Intergenic
1105996116 13:25673686-25673708 CTATTGGTGCGTAGGAAAAATGG + Intronic
1106243166 13:27925842-27925864 CTGGGGGTGAGGGAGAAAGATGG + Exonic
1106351707 13:28936990-28937012 CTGGGGTTGTGGAGGAAATAGGG + Intronic
1106947023 13:34840105-34840127 GGGGGGGTGGGAAGGAAAAACGG + Intergenic
1107277974 13:38698496-38698518 CTGTGGGTGAGGAGAAAAACTGG + Intronic
1107727358 13:43312415-43312437 CTGGGGGTGCAAAGAAAACATGG + Intronic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1109594297 13:64530057-64530079 CTGGGGGGTGGGAGGAAAACAGG - Intergenic
1110595143 13:77312446-77312468 CTGGGGGAGGGGAGAATAAAAGG + Intronic
1110596678 13:77327146-77327168 GAGGGGGTGGGGAGGAAAAGGGG - Intergenic
1111492514 13:89000337-89000359 CTGAGGGTTGGGAGGAAGAAGGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114997711 14:28377266-28377288 GTGGGGGTGGGGATGATAAATGG + Intergenic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1117049224 14:51843931-51843953 CAAGGGGTGGGGAGGAGAAAGGG - Intronic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1119042106 14:71284061-71284083 CTGGGGGGAGGGAGGAAGAAAGG + Intergenic
1119251348 14:73157629-73157651 CTGGGGATGGGGAGGAATCAGGG - Intronic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1120240972 14:81949024-81949046 TTGGGGGGGCAGAGGACAAAAGG + Intergenic
1120685692 14:87534060-87534082 CTGGGGGTGGGGTGGAGGAATGG - Intergenic
1120722717 14:87905746-87905768 CTGGGGGTGCTGAGGAGGTAGGG - Intronic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1122012272 14:98759985-98760007 CTGGAGCTCAGGAGGAAAAATGG - Intergenic
1122603186 14:102931118-102931140 CTGGTGGGGCGGACGGAAAAGGG + Exonic
1123425933 15:20170267-20170289 CTGGGGGTTGTGAGGAACAAGGG + Intergenic
1123535165 15:21176791-21176813 CTGGGGGTTGTGAGGAACAAGGG + Intergenic
1124651848 15:31479766-31479788 TTGGGGGTGCTGAAGATAAAAGG - Exonic
1126143354 15:45455175-45455197 CTGGGGGTGGGGAGGAGGCAGGG - Intergenic
1126154915 15:45556965-45556987 TTGGGGGGGCGGGGGAAAGAAGG - Intergenic
1126876495 15:53047432-53047454 CTGGTGGAGGGGAGGAAAAGGGG - Intergenic
1127232766 15:57014828-57014850 ATGGGGGTGGGGAGGTATAATGG + Intronic
1127494286 15:59495188-59495210 CTGGGGAGGCTGGGGAAAAATGG - Intronic
1127578145 15:60312623-60312645 GTGGAGGTGAGGAGGAGAAAAGG + Intergenic
1128513575 15:68328062-68328084 CTGGGGGTGGGGAGAAAGGAGGG + Intronic
1130635858 15:85619269-85619291 CTGCGGGTGCGGAGCTGAAAGGG + Intronic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1131273207 15:90959408-90959430 CTGTGGGTGCAGTTGAAAAAGGG + Intronic
1131308971 15:91270729-91270751 GTGGGAGTGAGGAGGAAACAGGG + Intronic
1131360897 15:91789539-91789561 AGGGGAGGGCGGAGGAAAAATGG + Intergenic
1132826762 16:1909140-1909162 CTGGGGGTGGGAAGGAATACAGG - Intergenic
1133707601 16:8369994-8370016 TTGGGGGTGAAGAGGAGAAAAGG + Intergenic
1133866025 16:9644134-9644156 GTGGGGGTGCAGAGGAAAGAGGG + Intergenic
1134842393 16:17412292-17412314 CTGGGGGTGCAGAGGTATACAGG + Intronic
1134842445 16:17412586-17412608 GTGGGGGTGGGGAAGAAAAGAGG + Intronic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136417387 16:30112425-30112447 CTGGGGGTGGTGTGGGAAAAGGG + Intronic
1136591902 16:31222804-31222826 CTGGGGGTGGGGAGGGGAAGGGG - Intronic
1136858319 16:33679251-33679273 CTGGGGGTTGTGAGGAACAAGGG - Intergenic
1137609617 16:49809939-49809961 CTGGGGGTGGGAGGAAAAAATGG - Intronic
1137903042 16:52289916-52289938 CTGGGGATACGGAGGTAAAGAGG + Intergenic
1138106213 16:54288223-54288245 ATGGGGGCGGGGAGGAAACAAGG + Intergenic
1138413534 16:56858268-56858290 CAGGGGGTGCAGAGAAACAATGG - Intergenic
1138468015 16:57207966-57207988 CTGGAGGTGTGGAGGTAAAAAGG - Intronic
1138661343 16:58519888-58519910 CTGGTGGTGAGGAGGAAAAGTGG - Intronic
1138707704 16:58934568-58934590 GTGGGGGTGGGGAGGAAGGAAGG - Intergenic
1139422192 16:66855718-66855740 CTGGGGGTGCTGAGGAGTGAGGG + Intronic
1139606940 16:68025695-68025717 CTGTGAGTGAGGGGGAAAAAAGG - Intronic
1139998950 16:71007657-71007679 CTGGTGAGGCAGAGGAAAAAAGG + Intronic
1140393225 16:74606509-74606531 CTGGGAGTGAGGAGCAAAGAGGG + Intronic
1203119888 16_KI270728v1_random:1527721-1527743 CTGGGGGTTTTGAGGAACAAGGG - Intergenic
1142908817 17:3069679-3069701 CTCGGGGAGTGTAGGAAAAATGG + Intergenic
1142925750 17:3234564-3234586 CTCGGGGAGTGTAGGAAAAATGG - Intergenic
1143021848 17:3921010-3921032 CTGGGGGTGCTGAGGAAAGATGG - Intergenic
1143290388 17:5823492-5823514 CTGGGGGTGGGGAGGAGATGGGG + Intronic
1143638541 17:8181510-8181532 CTGTGGGTGAGTGGGAAAAAGGG + Intergenic
1144078523 17:11740825-11740847 CTGGGGGCGGGGAGGAATAGGGG - Intronic
1144409950 17:14991206-14991228 CTCGGGGTCTTGAGGAAAAATGG - Intergenic
1146688392 17:34856815-34856837 ATGGGGGTGCGGAGGATGGAGGG + Intergenic
1147309871 17:39589159-39589181 TTGGGGGTGTGGAGGAAAATGGG - Intergenic
1147443190 17:40459927-40459949 GTGGGAGTAGGGAGGAAAAATGG + Intergenic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1149337197 17:55648088-55648110 ATGGAGGTGGGGAGGAAAAAGGG + Intergenic
1149579740 17:57741274-57741296 CTGAGAGTGGGGAGGAGAAATGG + Intergenic
1149654029 17:58300997-58301019 CTGGGGTTGTGGAGGAAGATGGG - Intergenic
1151338061 17:73451951-73451973 CAGGGGGTGTGGCTGAAAAATGG - Intronic
1151713123 17:75817946-75817968 TAGGGGGTGGGGAGGAAGAAGGG + Intronic
1152551479 17:81032559-81032581 CTGGGGGTGCTGAGTACCAAGGG - Intergenic
1152599201 17:81253036-81253058 CTGGGGGTGCGGATGGGGAAGGG - Intronic
1152782381 17:82232010-82232032 CAGGGGCTGCGGGGGAAGAAGGG + Intronic
1153463020 18:5357872-5357894 CTGGTGGTGGGAAGGTAAAATGG + Intergenic
1153779725 18:8483791-8483813 ATGGGGGAGAGGAGAAAAAAGGG - Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1154929570 18:20978760-20978782 CTTGAGGTGGGGAGGAAAGAAGG + Intronic
1155241780 18:23870820-23870842 CAGGGGCTGGGGAGGGAAAAAGG + Intronic
1157753578 18:50198665-50198687 CTAGTGGTGAGGAGGAGAAAGGG - Intergenic
1158270172 18:55704362-55704384 GTGGGGATGGGGAGGAAAAATGG + Intergenic
1158478839 18:57803254-57803276 CCGGCGGAGCGGAGGCAAAAGGG - Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160688688 19:450107-450129 CTGGGGGTGCCGCGGAAATGTGG + Intronic
1160717952 19:584910-584932 CTGAGGGTGCGGCAGAAAGATGG - Intergenic
1160825360 19:1077767-1077789 ATGGGGGTGGGGAGGAAAGGAGG + Intronic
1161837807 19:6659823-6659845 ATGGGGATGAGGAGGAAAAGGGG + Intergenic
1161845731 19:6710927-6710949 CCAGGGGTGCGGAAGAAACAAGG + Intronic
1165105087 19:33464496-33464518 GTGGGGGTGGGGAGGAAACGAGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166247343 19:41538506-41538528 CTGGGGGTGGTGAGGAGAACTGG - Intergenic
1166816822 19:45551277-45551299 CTTGGGGTGAGGAGGAATAGTGG + Intronic
1167050616 19:47075676-47075698 CTGGGGGTGCTGAGGAGGCAGGG - Intronic
1167622272 19:50566879-50566901 CTGGGGGTGTTGGGGAGAAAGGG + Intronic
925257502 2:2502795-2502817 GTGGGGGTGCAGAGGAAATGTGG - Intergenic
925539986 2:4956497-4956519 CTGGGGGTGCTGAGGGGAATGGG + Intergenic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
928287345 2:30004439-30004461 GTGGGGGTGAGGAGGAAAAAAGG - Intergenic
928703308 2:33921086-33921108 CTGAGAGTGAGGAGGAGAAAAGG - Intergenic
929640118 2:43569738-43569760 CTGGGCCTGAGGAGCAAAAAAGG + Intronic
929656116 2:43733404-43733426 CTGGAGGAGTGGAGGAGAAAGGG - Intronic
930873633 2:56190825-56190847 CTGGGGTAGGGGAGGAAAGAAGG - Intronic
931130895 2:59334289-59334311 GTGGGGGTGGAGAGGAAGAAGGG - Intergenic
931847923 2:66223524-66223546 CTGGGAGGGAGGAGGAAAAAAGG + Intergenic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
932614354 2:73222658-73222680 CTAGGGGAGGGAAGGAAAAAGGG - Intronic
933752078 2:85609341-85609363 TTGGGGGTCCTGAGGAAAACAGG + Intronic
933806026 2:85998494-85998516 CTGGGGGTGGGGACGAGAGAGGG + Intergenic
933851403 2:86369529-86369551 CTAAGGGTGCAGAGGAAGAAGGG + Intergenic
934562702 2:95321145-95321167 CTGGGGGTGCCGGGGAGGAAAGG - Intronic
934647678 2:96068528-96068550 CAGGGTGTGCAGGGGAAAAAAGG + Intergenic
934841052 2:97624348-97624370 CAGGGTGTGCAGGGGAAAAAAGG + Intergenic
935430112 2:102966778-102966800 CAGGAGGTGGGGTGGAAAAAAGG + Intergenic
935924836 2:108056072-108056094 CTGGGGAGGGGGAGGAAAATTGG + Intergenic
937044790 2:118845487-118845509 CTGGATGTGCGGGTGAAAAAAGG + Intronic
937226262 2:120371762-120371784 CTGGGGGGTGGGAGGAAACAGGG - Intergenic
937899863 2:127011692-127011714 CTGGGGGAGGGGAGGAGGAAAGG - Intergenic
937909540 2:127068792-127068814 CTGGGGGTGGGGACGATACAGGG - Intronic
940326819 2:152434308-152434330 CAGGGGGTATGGAGGAATAAAGG + Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941173897 2:162173490-162173512 TTGGGGGTGGGGAGGAAGATTGG + Intronic
942452323 2:176116176-176116198 CTAGGAGGGCGGAGGCAAAAAGG - Intronic
944362836 2:198878545-198878567 CTGAGAGTGAGCAGGAAAAATGG - Intergenic
946603386 2:221375168-221375190 CTGAGTGTGAGGAGGAAGAAAGG + Intergenic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948942671 2:241204017-241204039 CTGTGTGTGCGGATGAGAAAGGG - Intronic
1169977457 20:11346171-11346193 ATGGTGGTGGGGAGGAAATAAGG - Intergenic
1171794828 20:29558677-29558699 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1171853628 20:30325588-30325610 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1172015365 20:31869921-31869943 CTGGGGCTGGGGAGGCAGAAAGG + Intronic
1172208250 20:33179855-33179877 CTGGGGTTGCTGGGGAGAAATGG + Intronic
1172774070 20:37397160-37397182 CTGGAGAAGCGGAGGACAAAGGG - Intronic
1173012950 20:39199157-39199179 ATGGGTGTCCGAAGGAAAAATGG + Intergenic
1173584529 20:44172262-44172284 ATTGGGGTGAGAAGGAAAAAGGG + Intronic
1173672075 20:44805814-44805836 CTGGGGGTGTGGAGAGAAATCGG + Intronic
1174610850 20:51797692-51797714 GTGGGGGTGGGGTGGAGAAATGG - Intronic
1175256633 20:57652011-57652033 CTGGGGCTGCGTAGGTGAAAAGG - Exonic
1175844425 20:62051164-62051186 CTGGGGCTGAGGAGCAAGAAGGG + Intronic
1176636603 21:9249657-9249679 CTGGGGGTGAGAAGAGAAAATGG - Intergenic
1178880457 21:36446146-36446168 CTGGGGATGCGGTGGAGAGAGGG + Intergenic
1179340152 21:40500121-40500143 CTGGGAGGGAGGAGGAGAAAAGG + Intronic
1179587856 21:42385076-42385098 AGGGGGGTGGGGAGGAAAAGAGG - Intronic
1180025817 21:45161493-45161515 CTGGGGGTGCCGAGGCAGCAGGG - Intronic
1180819187 22:18813871-18813893 CTGGGCGTGGGGTGGAGAAAAGG - Intergenic
1181205412 22:21248319-21248341 CTGGGCGTGGGGTGGAGAAAAGG - Intergenic
1181387705 22:22557879-22557901 CTGGGGGTGGGGAGGAGATGGGG + Intronic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1182183144 22:28372491-28372513 AGGGAGGTGCGGAGGGAAAATGG - Intronic
1182371111 22:29811677-29811699 CTCAGGGTGAGGAGGAAGAAAGG - Intronic
1182388692 22:29970953-29970975 CTGGGGGTGGGGGGGAAGAGGGG - Intronic
1183291084 22:37002388-37002410 ATGGGGGTGAGGAGGGGAAACGG + Intronic
1183350217 22:37330748-37330770 TTGGGGGCGGGGAGGAGAAAAGG + Intergenic
1183585535 22:38751005-38751027 CTGCGGGTGCGGAGGAGGAGAGG - Exonic
1184590120 22:45476431-45476453 CTGGTGGTGCTGAGGAGACACGG + Intergenic
1185229311 22:49671037-49671059 CTGGGGGTGCAGAGGACGCAGGG - Intergenic
1185286982 22:50006005-50006027 ATGGGGGTGCTGAGGAAAGCAGG + Intronic
1203221513 22_KI270731v1_random:47097-47119 CTGGGCGTGGGGTGGAGAAAAGG + Intergenic
1203269313 22_KI270734v1_random:39724-39746 CTGGGCGTGGGGTGGAGAAAAGG - Intergenic
950360244 3:12444813-12444835 ATGGGGGTGGGAAGGAAGAACGG - Intergenic
950635122 3:14308716-14308738 CAGGGGGTGGGGAGGACAAAGGG + Intergenic
951515637 3:23556014-23556036 ATGGGGGTGGGGAGGGAAATGGG + Intronic
952070972 3:29635476-29635498 CTGGTGGAGAGGAGGAGAAATGG - Intronic
952395445 3:32916881-32916903 TTGGGGTTGCAAAGGAAAAATGG + Intergenic
952461564 3:33531915-33531937 CTGGTGGTGGGGAAGTAAAATGG + Intronic
953241715 3:41155422-41155444 CTCGGGGTGTGCAGGGAAAAGGG + Intergenic
953630236 3:44609289-44609311 CTGTTGGTGCGGATGTAAAATGG + Intronic
955065304 3:55528878-55528900 CTGGGGGTGGGGAGGGATATGGG + Intronic
957104160 3:75865607-75865629 CTGGGGGTGATGAGAGAAAATGG + Intergenic
960096098 3:113691281-113691303 CTGGTGGTTGGGAGGAAGAATGG - Intronic
960268613 3:115649911-115649933 CTGGCTGTTCAGAGGAAAAATGG + Intronic
961180581 3:124873415-124873437 GTGGGGGAGGGGAGGAAGAAGGG - Intronic
962668799 3:137684157-137684179 TTGGGGGTGCTGAAGAGAAAGGG - Intergenic
962755088 3:138460478-138460500 GTGGGGGTTCGGAGGAAAGCAGG - Intronic
963785024 3:149525760-149525782 CTGGGAGTGGGGAGGAACAAGGG + Intronic
964057473 3:152478978-152479000 CTAGGGGTGGGAAGGAGAAAGGG - Intergenic
965475028 3:169146588-169146610 CTGCGGGCGAGGAGGAAAGAAGG + Intronic
967278985 3:187804424-187804446 CTGGGGGTGGGCAGGAAGCATGG + Intergenic
968185378 3:196630108-196630130 CTGGGGGTTTGGGGGAAAATGGG - Intergenic
1202750292 3_GL000221v1_random:155362-155384 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
969591481 4:8124418-8124440 CAGGGGCTGCGGAGGGAAAACGG - Intronic
970556882 4:17242866-17242888 CTGAGTGTGGGGAGGAAAAGGGG - Intergenic
971378769 4:26077555-26077577 TTGGGGGGGCAGAGGATAAACGG + Intergenic
971409681 4:26356997-26357019 GTGGGGATGGTGAGGAAAAAGGG + Intronic
972703310 4:41515281-41515303 CTGGGGACGCGGAGGAAGGAAGG - Intronic
972734071 4:41823220-41823242 CTGAAGGTAAGGAGGAAAAAAGG + Intergenic
973280504 4:48355286-48355308 TTGGGGGTGAGGAGGCATAAGGG + Intronic
974033898 4:56800447-56800469 GTGGGGGAGAGGAGGAAGAAAGG - Intergenic
974683554 4:65195259-65195281 CTGAGGGTGCTGAGGAAGAAGGG + Intergenic
976151030 4:82092002-82092024 CTGGGGTTGGGAAGGAAAAATGG + Intergenic
976628760 4:87216146-87216168 CTGGGGGTGGGGAAGAAGAGAGG + Intronic
978036830 4:104005132-104005154 CTGGAGGTGGGTAGGAGAAATGG + Intergenic
978400191 4:108322884-108322906 GAGGGGGTGGGGAGGAGAAAGGG + Intergenic
978619039 4:110621557-110621579 CTGGGGGAGGGGAGGAAATGGGG - Intronic
979402231 4:120262469-120262491 GTGGGGGTGGGGAGGAATTATGG + Intergenic
981674327 4:147323677-147323699 GTGGAGGTGGGGAGGAAACACGG + Intergenic
982253660 4:153432165-153432187 CTGGGGGTGCTGAGGAAGGAGGG + Intergenic
984541188 4:181039621-181039643 CAGGGGGTGGGGAGGGATAAGGG - Intergenic
984897795 4:184557278-184557300 CTGGTGAGGCGGAGGAGAAAGGG + Intergenic
1202751491 4_GL000008v2_random:8096-8118 CTGGGGGTGAGAAGAGAAAATGG - Intergenic
985947347 5:3196448-3196470 CAGGGGCTGCGGTGGAACAATGG + Intergenic
985957686 5:3276996-3277018 CTGAGGGTGCCGAGGAGACAAGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
989102577 5:37835956-37835978 CTGGGGGTGGGTTAGAAAAAGGG + Intronic
989547363 5:42690081-42690103 CTGGGGGTTGGGTGGAAAACAGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994043553 5:95284466-95284488 CTGGGGGTGGGCAGGAGCAAGGG - Exonic
995540229 5:113178549-113178571 TTGGGGGTGAGGAGGAAATGTGG - Intronic
996008379 5:118451232-118451254 ATGGGGGTGGGGAGGAAGAATGG + Intergenic
998385412 5:141754510-141754532 CTGGGGGTATGGAGGAACCAAGG - Intergenic
998461826 5:142315156-142315178 CTGGGGGTGGGGTGGGGAAAAGG + Intronic
999232580 5:150070294-150070316 CTGGGGGGTCTGAGGAAGAAAGG + Exonic
999673467 5:153977130-153977152 CTTGGGGTGCAGTGGAAGAAGGG - Intergenic
1001983193 5:176050840-176050862 CTGGGGGGGAGGAGGAAGTAAGG - Intronic
1002234272 5:177793212-177793234 CTGGGGGGGAGGAGGAAGTAAGG + Intronic
1002558497 5:180063025-180063047 CTGGGGGTGGGGAGGAGGAAGGG + Intronic
1002639382 5:180623495-180623517 CTGGAGGTGTGTAGGAAAACAGG + Intronic
1003081168 6:3023000-3023022 CTGGGGGCGTTGAGGAAGAAGGG - Intergenic
1003701220 6:8467197-8467219 GTGGGGGTGTGGATGAAAAGTGG + Intergenic
1004402967 6:15305717-15305739 ATGGGGGTGGGGAGGAATCAAGG - Intronic
1004455423 6:15787414-15787436 CTGGGGGTGGAGGGGAAAATGGG + Intergenic
1004461338 6:15839788-15839810 CTGCTGGTGGGGAGGCAAAATGG - Intergenic
1004570540 6:16840389-16840411 GTGGGGGTGGGGAGGGAAAGTGG + Intergenic
1005739124 6:28774488-28774510 GTAGGGATGAGGAGGAAAAAGGG + Intergenic
1005809620 6:29506056-29506078 CTGAGGGTGGGGATGAAGAAGGG - Intergenic
1005913173 6:30327987-30328009 ATGGGGGTCGGGAGGAGAAAAGG + Intronic
1006104869 6:31710462-31710484 CTGGGGATGGAGAGGAAACACGG + Intronic
1006308572 6:33240682-33240704 CTGGGGGAGTTGAGGAGAAAAGG + Intergenic
1006337793 6:33429506-33429528 CTGGGTGTGGAGAGGAAGAAAGG + Intronic
1007285545 6:40744822-40744844 CTGGGGGTGGGGAGAGAAAAAGG - Intergenic
1007322709 6:41039017-41039039 CTGGAGGAGGGGAGGAAAATGGG - Intronic
1007585728 6:42988100-42988122 TTGGAGGTGGGGAGGAAGAAAGG - Intronic
1007670599 6:43549935-43549957 CTAAGGGAGAGGAGGAAAAAAGG + Intronic
1007951158 6:45873648-45873670 CTGGGAGGGCATAGGAAAAAGGG - Intergenic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1010350638 6:74870219-74870241 CTGGGGGAAAGGAGGAAATAAGG - Intergenic
1010807647 6:80257862-80257884 CTGGGAGTCCGAAGGAAAAAAGG - Intronic
1011870424 6:91886085-91886107 CTGAGGCTTAGGAGGAAAAATGG + Intergenic
1012309934 6:97710616-97710638 ATGGGAGTGCAGAGGAAAAGTGG - Intergenic
1012378489 6:98590886-98590908 CTGGGTGTGAGGAGGAAGAAAGG + Intergenic
1012515782 6:100057549-100057571 CTCGGAGTGGGGAGGACAAAGGG - Intergenic
1013743604 6:113318769-113318791 CTGGGGCTGGGGAGGAAGGAAGG - Intergenic
1015413392 6:132920386-132920408 CTGGGGGTCAGGAGGAAACGAGG - Intergenic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016683132 6:146853373-146853395 CTGGGGGTCTGGAGGAAATGAGG - Intergenic
1016848252 6:148590657-148590679 CTGGTGGGGAGGAGGAAATAAGG + Intergenic
1018576313 6:165263621-165263643 CTGAGGGTGTGGTGGAAGAAGGG + Intergenic
1019187907 6:170231719-170231741 TCTGGGGTGGGGAGGAAAAAGGG - Intergenic
1019718069 7:2550714-2550736 CTGGGAGGGAGGAGGAAACAGGG + Intronic
1020847508 7:13306117-13306139 GTGAGGATGCGGAGAAAAAAAGG + Intergenic
1022209181 7:28191956-28191978 CAGAGGCTGGGGAGGAAAAAGGG + Intergenic
1022370491 7:29766497-29766519 CTGGAGGTGAGGAGGAGAAGGGG - Intergenic
1022806173 7:33824658-33824680 CTGGGGGTGCATTGGAAAACTGG - Intergenic
1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG + Intronic
1024020886 7:45367760-45367782 CTGGGGGTGGGTGGGAGAAATGG - Intergenic
1024189428 7:46990672-46990694 CAGGGGCTGGGGAGGGAAAATGG + Intergenic
1025094656 7:56087777-56087799 CTGGGAGTGCAGAGGACAGATGG + Intronic
1025212573 7:57028687-57028709 CTGGGGGTGGGCAGGAAGGAGGG - Intergenic
1025659380 7:63548140-63548162 CTGGGGGTGGGCAGGAAGGAGGG + Intergenic
1025913005 7:65842442-65842464 CTGGGGGTGAGGAGGGGAATGGG + Intergenic
1027221737 7:76218438-76218460 CTGGGGCTGCTGAGCAAGAATGG - Intronic
1028380858 7:90196940-90196962 CTGGGAGTGAGGAAGAAGAAGGG - Intronic
1028983718 7:96993852-96993874 CTGGGGATGAGGTGGAGAAAGGG - Intergenic
1029170176 7:98624899-98624921 CTGGGGGTTGGGAGGAAGAGAGG - Intronic
1029605593 7:101597863-101597885 GTGGGGGTGGGGAGGATAGAAGG - Intergenic
1030849145 7:114461014-114461036 TTGAGTGTGCAGAGGAAAAACGG + Intronic
1032576063 7:133056368-133056390 GTGGGGGCGAGGAGGAGAAAGGG - Intronic
1033067572 7:138171029-138171051 ATAGGAGTGCGGAGGACAAAAGG + Intergenic
1033870860 7:145751988-145752010 CTGGGGGTGGTGAAGAAAACTGG + Intergenic
1036208034 8:6819499-6819521 CTGGGGGTGTTGAGGAACAGTGG + Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1039385504 8:37132066-37132088 CGGGGGGTGGGGGGGAACAAGGG - Intergenic
1039444538 8:37620686-37620708 CTGGGGGTGGGGAGGGTGAAGGG - Intergenic
1040470431 8:47731750-47731772 CTGGGGGTAGGGAGGAAGAAAGG + Intronic
1041627739 8:60049941-60049963 GTGGAGGTGGGGAGAAAAAAGGG - Intergenic
1042763940 8:72300340-72300362 TTGGGGGTGCAGAGGAAAATGGG - Intergenic
1044503728 8:92992234-92992256 CTGGGGGAGTGGAGGAGAAATGG + Intronic
1044794365 8:95881615-95881637 TTGGGGGTAGGGAGGAAAAAGGG + Intergenic
1045068786 8:98478322-98478344 TTGGGGGTGGGGTGGAAGAAGGG + Intronic
1045820550 8:106332047-106332069 CTGAGGATGGGGAGGAAGAAGGG - Intronic
1047388922 8:124434153-124434175 ATGGGGATGCAGAGGAAACAAGG - Intergenic
1047779035 8:128096944-128096966 CTGGGGAGGCAGAGGAAACATGG - Intergenic
1047995658 8:130333159-130333181 TTGGGGGTGCTTAGGAAATAAGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1050467271 9:5940689-5940711 TTGGGGGTAGGGAGGACAAATGG + Intronic
1050725430 9:8643726-8643748 CTGGGGGTGCTGAGGCAGCAAGG - Intronic
1050835664 9:10075677-10075699 CTGGGGGGGAGGGGGAAAATTGG + Intronic
1051198129 9:14586270-14586292 CAGGGGGTGGGGAGCAAAACTGG + Intergenic
1052879226 9:33590474-33590496 CTGGGGGTGGGGGTGAAAGATGG + Intergenic
1052994894 9:34546713-34546735 CTGAGGATGGGGAGGAGAAATGG - Intergenic
1053001271 9:34578380-34578402 CTGGGGGAGGGGAGGCAGAAGGG + Intronic
1053135355 9:35647227-35647249 CTGGGGATGCGGAGGAGGGAGGG - Intergenic
1053496752 9:38553745-38553767 CTGGGGGTGGGGGTGAAAGATGG - Intronic
1053791432 9:41688885-41688907 CTGGGGGTGAGGATGTCAAACGG + Intergenic
1054473509 9:65557005-65557027 CTGGGGGTGAGGATGCCAAACGG - Intergenic
1054657760 9:67680242-67680264 CTGGGGGTGAGGATGTCAAACGG - Intergenic
1055369186 9:75578679-75578701 CTGGATGTGAGGGGGAAAAATGG + Intergenic
1056902120 9:90609499-90609521 CTGGGGTTGTGGAGGAAAGCAGG + Intergenic
1057416171 9:94863998-94864020 TTGGGGGTACTGAGGAAGAAGGG + Intronic
1057570723 9:96202385-96202407 ATGGGGGTGAGGAGGACAAGAGG + Intergenic
1057676667 9:97141301-97141323 CTGGGGGTGGGGGTGAAAGATGG - Intergenic
1058071854 9:100609459-100609481 CTGGGAGTGAGGAGGTTAAAGGG + Intergenic
1059102996 9:111487507-111487529 ATTGGGGTGAGGAGGAAAACAGG + Intergenic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1059695770 9:116728879-116728901 CTGGGGATGCTGAGGAAATGAGG - Intronic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1062659222 9:137619418-137619440 GGGGAGGTGCGGAGGACAAAAGG + Intronic
1203718932 Un_KI270742v1:185455-185477 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1203653166 Un_KI270751v1:149130-149152 CTGGGGGTGAGAAGAGAAAATGG + Intergenic
1185481175 X:447507-447529 CTGGGAATGGGGAGGGAAAATGG - Intergenic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186923949 X:14311606-14311628 CTGGGGGAGAGGTGGAAAATGGG + Intergenic
1189075054 X:37905950-37905972 CTGGGGGTGGGGAGGGAGAGGGG + Intronic
1189267676 X:39729423-39729445 CTGGGGATGGGGAGGAGAATGGG + Intergenic
1189472824 X:41327489-41327511 CTGGGGGTGGGGTGGTAAAAGGG + Intergenic
1190502646 X:51095179-51095201 ATGGGGGTGGGGAAGAGAAAGGG - Intergenic
1190879044 X:54479670-54479692 CTGGGGGTGGGGTGGGGAAAGGG + Intronic
1192229542 X:69255735-69255757 CTGTGTGTGCGGAAGAACAAAGG - Intergenic
1192449367 X:71234004-71234026 ATGGGGATGCTGAGGAGAAAAGG - Intergenic
1192537746 X:71942792-71942814 CTGGGGGTGGGGGGCAAAAGAGG - Intergenic
1192888056 X:75358036-75358058 CTGGTGGAGCGGAGGGAAAATGG + Intergenic
1193541494 X:82778220-82778242 CTGGGGGAGAGGGGGAAACAAGG - Intergenic
1196196347 X:112841415-112841437 GCGGGGGAGCGGAGGAAGAAAGG - Intergenic
1196398447 X:115290045-115290067 CTGGAGGTGAGGAGAAAAAGAGG - Intronic
1196795736 X:119500868-119500890 TTGGGGGTGGGGTTGAAAAAGGG - Intergenic
1198018004 X:132631319-132631341 CTGGGAGTGAGGATGGAAAAGGG + Intronic
1198370718 X:135986061-135986083 CTGGGGGTGCGGAGGAAAAAGGG - Intronic
1199779890 X:151048646-151048668 GTGGGGGAGGGGAGGTAAAAAGG - Intergenic
1200045461 X:153398511-153398533 CTGGGGCTGTGCAGGAAAACTGG + Intergenic
1200074441 X:153544172-153544194 CTGGGGGTGCGCAGGCAGATGGG + Intronic
1201173088 Y:11290297-11290319 CTGGGGGTGAGAAGAGAAAATGG + Intergenic