ID: 1198373095

View in Genome Browser
Species Human (GRCh38)
Location X:136011037-136011059
Sequence TAGAGCACAAAGTTTAAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 333}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198373095_1198373098 -9 Left 1198373095 X:136011037-136011059 CCGATTTTAAACTTTGTGCTCTA 0: 1
1: 0
2: 1
3: 32
4: 333
Right 1198373098 X:136011051-136011073 TGTGCTCTAGAGCCCTGGACGGG 0: 1
1: 0
2: 1
3: 14
4: 133
1198373095_1198373097 -10 Left 1198373095 X:136011037-136011059 CCGATTTTAAACTTTGTGCTCTA 0: 1
1: 0
2: 1
3: 32
4: 333
Right 1198373097 X:136011050-136011072 TTGTGCTCTAGAGCCCTGGACGG 0: 1
1: 0
2: 0
3: 33
4: 170
1198373095_1198373099 2 Left 1198373095 X:136011037-136011059 CCGATTTTAAACTTTGTGCTCTA 0: 1
1: 0
2: 1
3: 32
4: 333
Right 1198373099 X:136011062-136011084 GCCCTGGACGGGAAGCCCAAAGG 0: 1
1: 1
2: 0
3: 6
4: 136
1198373095_1198373104 21 Left 1198373095 X:136011037-136011059 CCGATTTTAAACTTTGTGCTCTA 0: 1
1: 0
2: 1
3: 32
4: 333
Right 1198373104 X:136011081-136011103 AAGGACCTGAGTTGTAGTCCTGG 0: 1
1: 0
2: 3
3: 36
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198373095 Original CRISPR TAGAGCACAAAGTTTAAAAT CGG (reversed) Intronic
904683756 1:32246676-32246698 TTGAAAACAAAGTTTAAAAAAGG + Intergenic
906622592 1:47296095-47296117 TAGAGCAAAACTTTTAAAAAAGG - Intronic
907882165 1:58560775-58560797 TAGAGTACATAGTTTACATTAGG - Intergenic
908209557 1:61886473-61886495 TTGAACACAAGGTTAAAAATTGG + Intronic
908289989 1:62655946-62655968 TAGAGCAGAAATTTGAAACTGGG + Intronic
908674560 1:66589322-66589344 AAGAAAACAAAGTCTAAAATAGG - Intronic
908918741 1:69164462-69164484 TTGAGCTCAATGTTTGAAATAGG - Intergenic
909238566 1:73182558-73182580 TAGAAAACACAGTTTAAAAATGG - Intergenic
909802988 1:79837014-79837036 TAAAGCACATACTTTAAAAAAGG + Intergenic
910120039 1:83777457-83777479 TAGAGCAGAATATTTAAAATGGG + Intergenic
910443492 1:87277115-87277137 CAGACCCCAAAGTTTAATATTGG + Intergenic
910655808 1:89616735-89616757 GAGAGCATAAAGTTTAAATTTGG + Intergenic
910953490 1:92676334-92676356 TCAAACACAAAGTTTAAAAAGGG + Intronic
911282188 1:95943583-95943605 TAGAGCACAAATTTAAATATAGG - Intergenic
911862923 1:102977182-102977204 TTGAGCACACAGTTGAAAAATGG - Intronic
911984543 1:104604033-104604055 TTAAGCATAAAGCTTAAAATAGG + Intergenic
912305912 1:108566879-108566901 TAGGGCACAAAGTTTCAATTAGG + Intronic
912659892 1:111518110-111518132 TATAGCAAAAAGGTTAAAAGTGG - Intronic
913149264 1:116024439-116024461 CAGAGAATAAATTTTAAAATAGG + Intronic
917380494 1:174400965-174400987 TAGGGACCAAAGTTTAAAAAAGG + Intronic
918885416 1:190186976-190186998 TAGATCACACAGTTTAATACTGG - Intronic
920596467 1:207277025-207277047 AACAGCACAAAGTTAAAAAGTGG - Intergenic
920846756 1:209599811-209599833 GAAAGCACAAAATTTAAAAAAGG - Intronic
923060048 1:230463571-230463593 TAAGGCTCAAAGTTTACAATAGG - Intergenic
1065647585 10:27852015-27852037 TGGAGCACCATGTTTAAAGTTGG + Intronic
1066031068 10:31425687-31425709 TAGTTCAAAAACTTTAAAATGGG - Intronic
1067999050 10:51310353-51310375 CAGAGCACAATGTTCATAATAGG - Intronic
1069615689 10:69804768-69804790 TAGTGCACAAAGAAGAAAATGGG + Intronic
1070187376 10:74078039-74078061 TAGAGCACTAAATTTACAAAGGG - Intronic
1073988931 10:109241260-109241282 TGGAACACAAAGTTCAAAAGTGG - Intergenic
1074326157 10:112453528-112453550 TATAACACAAAGGATAAAATAGG - Intronic
1074500253 10:114017347-114017369 TAGAGGAAAATGTTGAAAATGGG + Intergenic
1074804242 10:117031579-117031601 AAGAGCAAAAAGTTTAAAAGAGG + Intronic
1075779036 10:125005199-125005221 TTGAGCACAAAGTACAAAAAAGG + Intronic
1076180947 10:128407034-128407056 TAAAGGACAAATTTTAAAAATGG - Intergenic
1076227315 10:128789844-128789866 TAGACAACTCAGTTTAAAATGGG + Intergenic
1076555608 10:131319421-131319443 TAGAGCACAAAGAATAAGAGTGG + Intergenic
1076748832 10:132530072-132530094 AATAGCATAAAATTTAAAATAGG - Intergenic
1076781496 10:132727316-132727338 AAAAGCACAATGTTTAAAACGGG - Intronic
1076812108 10:132892250-132892272 AAAAGCACCACGTTTAAAATTGG + Intronic
1078012880 11:7587108-7587130 TAGAGCAAAAAGGTTAAGACAGG - Intronic
1078472521 11:11602969-11602991 TAGATCAGAATATTTAAAATTGG + Intronic
1079384279 11:19965120-19965142 TAGAACATAGAGATTAAAATAGG - Intronic
1080280779 11:30554422-30554444 CAGAGCAAAAATTTTAAAACAGG - Intronic
1081067085 11:38557106-38557128 TATAGAACATAATTTAAAATAGG - Intergenic
1081262463 11:40977664-40977686 TAGGGGACAGAGTTTAAAACAGG - Intronic
1082683416 11:56207918-56207940 TAGCACACAAAGTTTAAAAGTGG - Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1086022306 11:82245940-82245962 TGAAGCACAGAGTATAAAATTGG - Intergenic
1086187585 11:84037940-84037962 GAAAACACAAAGTTTAAAAATGG - Intronic
1086200647 11:84197413-84197435 TGGAGAACAAATTTTAAAAATGG - Intronic
1087333098 11:96808305-96808327 TAGAGTAAAAATTATAAAATCGG - Intergenic
1087601423 11:100320998-100321020 TTGAGCAAAAAGAATAAAATTGG - Intronic
1087637633 11:100720295-100720317 TAAAGCAAAAAGTTTAAGGTGGG + Intronic
1088171522 11:107003199-107003221 TATATAACAAAGTTTAAAAAGGG - Intronic
1088722409 11:112606058-112606080 TAGAGCTCAAAATGTGAAATAGG - Intergenic
1089080085 11:115768390-115768412 AAGAGCACAATGTTTCAAGTGGG - Intergenic
1089240997 11:117079108-117079130 TATAGCAAAAAGTTTAATAAAGG + Intronic
1094736394 12:33239623-33239645 AAGAGGACAAAGTTTCAGATTGG - Intergenic
1095043810 12:37475930-37475952 TAGAGAACATATATTAAAATTGG + Intergenic
1095357911 12:41297948-41297970 TACAGCACTAAGTCTAAAACAGG - Intronic
1095425538 12:42070961-42070983 CAAAACTCAAAGTTTAAAATGGG - Intergenic
1097477962 12:60083085-60083107 TAGATCACAAAGTCTGAAAGAGG - Intergenic
1097627073 12:62013025-62013047 TAAAGCACAAAGATTACAAGGGG + Intronic
1097668330 12:62507246-62507268 TCAAGCAAATAGTTTAAAATAGG - Intronic
1097802180 12:63926798-63926820 AAGAGTACAAAGTTTCACATTGG - Intronic
1098085584 12:66838890-66838912 TTCAGCGCTAAGTTTAAAATTGG - Intergenic
1098779896 12:74673662-74673684 TTGAGCACCAAGTGAAAAATAGG + Intergenic
1099083266 12:78213339-78213361 TAGAGCTAAAAGTTCAAAAGAGG - Intergenic
1099141097 12:78976238-78976260 AAGAAAAAAAAGTTTAAAATAGG + Intronic
1099546653 12:83990542-83990564 TAGAACACAAATTTTAGAAAGGG + Intergenic
1099845467 12:88023056-88023078 TAAAGCAAAAAGTTCAAAAAGGG + Intronic
1101037992 12:100723935-100723957 TAGAACAAACAATTTAAAATAGG + Intronic
1106053370 13:26213200-26213222 TATGGCACAATGTTTAATATTGG - Exonic
1107494430 13:40911185-40911207 GAGAGCAAGAATTTTAAAATTGG - Intergenic
1109158459 13:58941749-58941771 TACAGCAAAAAGTCTTAAATGGG - Intergenic
1109536042 13:63721304-63721326 TACAGCACTAAGTTTTATATGGG + Intergenic
1109540058 13:63764982-63765004 TACAGCACTAAGTTTTATATGGG - Intergenic
1109765129 13:66885259-66885281 TAGAGCATACAGTTCAAAATGGG + Intronic
1109937253 13:69304301-69304323 AAGAGCAAAAAGTTTTAAATAGG + Intergenic
1110611988 13:77498911-77498933 AAGAGCACAAAGTTGCAATTGGG + Intergenic
1111111663 13:83719234-83719256 CAGAGCACAAAGAATAAAGTAGG + Intergenic
1111734248 13:92117016-92117038 TAGAGCAAAAATTTTTAATTTGG + Intronic
1112890938 13:104230659-104230681 ATGAGAACAGAGTTTAAAATAGG - Intergenic
1114246731 14:20921248-20921270 TAGACCATAAAGTGTCAAATGGG - Intergenic
1115023616 14:28713639-28713661 TAGAGAACATAGTATCAAATAGG - Intergenic
1116494254 14:45541537-45541559 CTGAGCAAAAAGTATAAAATTGG - Intergenic
1116693920 14:48148541-48148563 TACATCTCAAAGTTTGAAATTGG + Intergenic
1117760312 14:59020043-59020065 AAGGGTACAAAGTTTAAATTAGG + Intergenic
1118879280 14:69812242-69812264 TAGAGCAGAAGGATTAAAACAGG + Intergenic
1120675142 14:87413251-87413273 TAAGTCATAAAGTTTAAAATAGG + Intergenic
1202942344 14_KI270725v1_random:163564-163586 TAGAGAACAAATATTAAAATTGG + Intergenic
1123897692 15:24844831-24844853 TTAAGCACAAAATTTAAAAATGG - Intronic
1126291076 15:47079940-47079962 TAGAGAACAAATATTAAAATTGG - Intergenic
1126402763 15:48290942-48290964 GAGAGCACAATTTTTGAAATTGG - Intronic
1126781461 15:52142710-52142732 TAGGGAACAATATTTAAAATGGG + Intronic
1127447345 15:59078040-59078062 TAGAGCACTAGCTTTAGAATTGG + Intronic
1128830140 15:70761342-70761364 TATAGCACATGGTTTAATATTGG - Intronic
1130245742 15:82246841-82246863 GAGACCAGAAGGTTTAAAATAGG + Intronic
1130974502 15:88762825-88762847 GAGACCACAATGTTAAAAATGGG + Intergenic
1133631416 16:7625586-7625608 AAGAGCTCGAAGATTAAAATGGG - Intronic
1135723917 16:24839908-24839930 TAGAGCACAAGTTCTAAAACTGG + Intergenic
1135939364 16:26807622-26807644 TAGAACACAGAGTCTAAAAATGG - Intergenic
1137930353 16:52581430-52581452 AAGATCACAAAGTTTATAAGTGG + Intergenic
1138202318 16:55099332-55099354 TTGAGCACAAAGTCAAAGATGGG - Intergenic
1138913354 16:61430518-61430540 TAGAAAACAAAGTTAAAGATGGG - Intergenic
1139151897 16:64391737-64391759 TAAAACTCAAAGTTAAAAATTGG - Intergenic
1140016564 16:71192486-71192508 TAGAGCATCAAGTGTAAGATAGG - Intronic
1140596171 16:76416253-76416275 TAGAGCACAAAGAATAAAATTGG - Intronic
1141355769 16:83345314-83345336 TATAGCACAAAGTTTAGCCTTGG - Intronic
1142929717 17:3272760-3272782 AAGGGCACAAAGTTTCAATTAGG + Intergenic
1144297808 17:13895684-13895706 TAGAGGACAAAGCATATAATGGG + Intergenic
1144690774 17:17261754-17261776 TAGAGCACAAGTTTGAAAACGGG + Intronic
1146074356 17:29714242-29714264 CATGGCACCAAGTTTAAAATAGG + Intronic
1146143912 17:30393538-30393560 TATAGTAGGAAGTTTAAAATAGG + Intronic
1148012422 17:44494095-44494117 TAGAACACAATGTTTGAAATAGG - Intronic
1149038911 17:52163812-52163834 TAAAACAAAAATTTTAAAATGGG + Intergenic
1149262366 17:54893898-54893920 TGGAGCCCAAAGCTTAAAGTAGG - Intergenic
1149582050 17:57757551-57757573 TAAAGCAGAAGGTTTTAAATGGG + Intergenic
1150166212 17:62946031-62946053 AAGAGCCCAAAGTCTAAAAGTGG - Intergenic
1150654351 17:67030272-67030294 TAGAGTACAAAGTTCAAATGAGG - Intronic
1151762336 17:76112441-76112463 TAAAGTCCATAGTTTAAAATGGG - Intronic
1156636688 18:39039388-39039410 TATATCACTAAGATTAAAATTGG - Intergenic
1156805058 18:41168292-41168314 TTGTGCAGAAAGTTAAAAATTGG - Intergenic
1156821016 18:41372809-41372831 TGGAGCACATAGTGTATAATAGG + Intergenic
1157174032 18:45434399-45434421 TAGTGCACAAAATATAAAATAGG - Intronic
1159912282 18:74157484-74157506 TCATGCACAAAGATTAAAATAGG - Intronic
1164922356 19:32098092-32098114 TAGATCAAAATTTTTAAAATTGG - Intergenic
1167808890 19:51811201-51811223 CAGAGCAGAAGGATTAAAATGGG - Intronic
1168483128 19:56738092-56738114 TAGAGCAGAAAGTAGAAAGTGGG - Intergenic
925695067 2:6567809-6567831 TATTGCACAAATTTTAAAAAGGG + Intergenic
926849390 2:17178253-17178275 TAGATCACAGAATTTAAATTGGG - Intergenic
929359606 2:41070432-41070454 AAGAGCACAGAGTTTAATAGTGG - Intergenic
930675477 2:54196362-54196384 TAAAGGACAAATCTTAAAATAGG - Intronic
931912185 2:66912409-66912431 TAGAACTAAAAGTTAAAAATGGG + Intergenic
931949667 2:67348918-67348940 TTGAGAAGAAATTTTAAAATAGG + Intergenic
931965636 2:67530686-67530708 TAAAGCACAAATTTTACAATGGG - Intergenic
932021403 2:68091101-68091123 TCGAGCACAAAATTTAAGGTAGG + Intronic
932444832 2:71772428-71772450 TAAAGAAAAAATTTTAAAATAGG + Intergenic
933189280 2:79314924-79314946 TAATGCACAAAGGTTATAATAGG + Intronic
934499603 2:94846606-94846628 AACAGCACATATTTTAAAATTGG - Intergenic
935460678 2:103329485-103329507 TGTAGCCCAAAGTATAAAATAGG - Intergenic
935462343 2:103353103-103353125 TTAATCACAAAGTTTCAAATGGG + Intergenic
938933679 2:136109908-136109930 CATAGAACAAAGCTTAAAATTGG - Intergenic
939368781 2:141270101-141270123 AAGAGCACCTAGTTTAAAAATGG + Intronic
940537420 2:154963294-154963316 TAAAGCACTGAGTTTAAAAAGGG - Intergenic
940624367 2:156153884-156153906 CAGGGCACAAAATTTTAAATGGG - Intergenic
941006499 2:160252483-160252505 TAGAGGAAAAAGATTACAATGGG + Intronic
941581971 2:167309199-167309221 TAGAGCAGAAAGGTTAGATTTGG + Intergenic
944518803 2:200541802-200541824 AAAAGCACAAAGGTCAAAATGGG - Intronic
945087425 2:206146362-206146384 AAAAGTATAAAGTTTAAAATTGG + Intronic
945644711 2:212476272-212476294 TAGAGCAAAAACTTTAAGTTAGG + Intronic
945959931 2:216122417-216122439 AAGAACACAAACTTTAAAAAGGG - Intronic
946994137 2:225371749-225371771 TACGGCACAAAGGTGAAAATTGG - Intergenic
947898989 2:233704190-233704212 TAGAGCATAAAAAGTAAAATGGG - Intronic
948300294 2:236901252-236901274 GTTTGCACAAAGTTTAAAATAGG + Intergenic
948367565 2:237467515-237467537 CAAAGTACAAAGTTTAAAAATGG - Intergenic
1169331534 20:4720394-4720416 TAGTGCACAGAGTTCACAATGGG + Intergenic
1170498048 20:16946112-16946134 TAGAGCAGAACTTTTAAAATTGG + Intergenic
1170998226 20:21386802-21386824 TACAGCACAAAGCCTAAAATCGG - Intronic
1171178080 20:23069894-23069916 TAAAGCCCAAAGTTTACATTAGG - Intergenic
1171538271 20:25918656-25918678 TAGAGAACAAATATTAAAATTGG + Intergenic
1171749315 20:29032518-29032540 TAGAGCCCACAGTTGAACATTGG + Intergenic
1171802870 20:29642784-29642806 TAGAGAACAAATATTCAAATTGG - Intergenic
1171841218 20:30213962-30213984 TAGAGAACAAATATTAAAATTGG + Intergenic
1171890836 20:30713313-30713335 AACAGCACATATTTTAAAATTGG - Intergenic
1173127143 20:40348047-40348069 TAGAACAAAAAGTTTAAAAGTGG + Intergenic
1174679443 20:52391669-52391691 TAGAGTTCTAATTTTAAAATGGG + Intergenic
1174719196 20:52793072-52793094 TATAGCACATAATCTAAAATAGG - Intergenic
1176315863 21:5243170-5243192 TAGAGCCCACAGTTGAACATTGG - Intergenic
1176580826 21:8523363-8523385 TAGAGAACAAATATTAAAATTGG - Intergenic
1177308944 21:19361408-19361430 CAGAGGACAAACTTTAAAAATGG - Intergenic
1177512411 21:22106306-22106328 AAGAGCACAAAGTTTCAGTTAGG - Intergenic
1179156370 21:38854474-38854496 TGGAGCACCATGTTTAAAAATGG + Intergenic
1183796151 22:40119975-40119997 TAAAGGACAAAGATAAAAATGGG + Intronic
951367135 3:21797145-21797167 TAGAGAACACAATTTAAAAATGG + Intronic
952329174 3:32348022-32348044 GAGAGCATAAACTTTAAAAAAGG - Intronic
952758583 3:36893976-36893998 TAGGGCAAAAAGTTAAGAATGGG - Intronic
954774260 3:53001991-53002013 TAGAAAACAAAGTTCAAAACAGG - Intronic
955609635 3:60743533-60743555 TAGAGCAAACATTTTAAACTTGG + Intronic
955852461 3:63235353-63235375 TTCAGCTCAAGGTTTAAAATAGG - Intronic
956186720 3:66569746-66569768 CAGAGCATAAAGTTCCAAATGGG - Intergenic
956956413 3:74346506-74346528 AAGATCACAAAGTGGAAAATGGG + Intronic
957125543 3:76155443-76155465 GATAGAACAAAGTTTACAATGGG + Intronic
957877457 3:86166598-86166620 CCGAGCACAAAATTTCAAATGGG - Intergenic
958179602 3:90042961-90042983 TAGAGCAAAAACCTTAAAACAGG + Intergenic
958538943 3:95444298-95444320 TAGAGAACAAAGATTGAACTGGG + Intergenic
958865940 3:99501888-99501910 TAGAGTACAGAGTTTAAATTAGG + Intergenic
958939291 3:100292379-100292401 TAGATCACACAGTTAATAATGGG - Intronic
959406097 3:105963259-105963281 TAGAGCAGAAAGATTAGAGTGGG + Intergenic
960726506 3:120675611-120675633 GACAACACAAAGATTAAAATTGG - Intronic
960937910 3:122914458-122914480 TAGAGCCCAGATTTGAAAATTGG - Intronic
963989237 3:151634092-151634114 AAGATCACAAAGTTTATAACTGG - Intergenic
964185937 3:153942674-153942696 TACAGAAGAAAATTTAAAATTGG - Intergenic
964853841 3:161123866-161123888 TAGGGCACAAAATTTTAAAAAGG + Intronic
965242947 3:166227449-166227471 TAAAGCACCCAGTTTACAATGGG - Intergenic
965379417 3:167969344-167969366 TTGAGCAAAAAGTTCAAAACTGG + Intergenic
965975672 3:174618226-174618248 TATGGAACAAATTTTAAAATAGG - Intronic
966270350 3:178097230-178097252 TATAGGACAGAGATTAAAATAGG + Intergenic
967463410 3:189774359-189774381 TAGAACACAAATTTTATACTTGG + Intronic
967546130 3:190730881-190730903 AAGAGCAAAAATTTTACAATTGG - Intergenic
969711161 4:8844882-8844904 TAGATCCTAAAATTTAAAATTGG + Intergenic
970103246 4:12549578-12549600 AAGAGCAAAAATTTTATAATTGG + Intergenic
970495962 4:16626429-16626451 TAAAGCCTAAAGTTTGAAATTGG + Intronic
971985806 4:33822275-33822297 AAGTGAACAAAGTTTAAATTTGG + Intergenic
972072211 4:35036423-35036445 TAAAACCCAAAGTTAAAAATGGG + Intergenic
973650089 4:52990604-52990626 TAAAGTACAAAGTTAAAACTGGG + Intronic
974374839 4:61062476-61062498 TAGAGCACAAAGTCTGGAAATGG - Intergenic
974575143 4:63709363-63709385 TATAGCACACAATTTATAATAGG - Intergenic
974724927 4:65786309-65786331 AAGAGCACTAACTTTGAAATTGG - Intergenic
974862390 4:67538358-67538380 TAGAGCACAATGTCTTAAAAGGG + Intronic
974998176 4:69188673-69188695 TATAACACAATGTTTAAAAATGG - Intronic
976840994 4:89432174-89432196 AAAAACAGAAAGTTTAAAATGGG + Intergenic
977505088 4:97892104-97892126 TATTGCACAAAGATTATAATAGG - Intronic
977596721 4:98890668-98890690 TATAGCAGAAAGTTAAGAATTGG - Intronic
978732592 4:112046975-112046997 TATAGCACTAAGATTACAATAGG + Intergenic
980145345 4:128976583-128976605 TTGAGCTGAAAGTTTAAATTGGG - Intronic
980145469 4:128978296-128978318 TAGGGCTGAAAGTTTAAATTGGG + Intronic
980971273 4:139569432-139569454 TAGAGGACAAATTACAAAATGGG + Intronic
982982279 4:162154609-162154631 CAGAGACCAAAGTTAAAAATGGG + Intronic
983009521 4:162529546-162529568 AAGTGCACAACTTTTAAAATAGG + Intergenic
983060991 4:163160742-163160764 TCCAGCACAAATTCTAAAATTGG + Intronic
984392297 4:179151578-179151600 TAGATCACAGATTATAAAATGGG + Intergenic
984996114 4:185431866-185431888 TAGAGCTCAAAATTCATAATTGG + Intronic
985431247 4:189882405-189882427 TAGAGCCCACAGTTGAACATTGG + Intergenic
986121718 5:4844157-4844179 TAGAGAAGACAGTTTAAAACAGG - Intergenic
986206962 5:5633840-5633862 TAGTGGAGAAAGTCTAAAATTGG + Intergenic
986372489 5:7093833-7093855 TAGAGCACGTTCTTTAAAATGGG - Intergenic
986401614 5:7387189-7387211 TAGAGCCCAAAGTTTAAGAAAGG - Intergenic
987170044 5:15245706-15245728 TAAAGCAAAATGTTTTAAATGGG + Intergenic
988172363 5:27675274-27675296 AAGAAGACAATGTTTAAAATGGG + Intergenic
988182940 5:27820989-27821011 TAGAACACACATTTTTAAATTGG + Intergenic
988654872 5:33199186-33199208 TTTAGCAGAAAGATTAAAATCGG - Intergenic
989561412 5:42856431-42856453 TAGAGCACTTAGTTTACAAAAGG - Intronic
990031804 5:51270334-51270356 TTCAGCACAAAGGTTCAAATAGG + Intergenic
990056018 5:51579449-51579471 TAGAGAACACATTTTAAGATGGG - Intergenic
990173073 5:53076848-53076870 TAAAGAACAAAAGTTAAAATGGG + Intronic
991076086 5:62540024-62540046 TAGAGGAGAAAGGTTAAAACAGG - Intronic
991393168 5:66171724-66171746 TAAAGCACAAGTTTTAAAAATGG - Intronic
992318610 5:75586788-75586810 AAGAGAACAAACTTGAAAATAGG - Intronic
992820314 5:80489399-80489421 AAGAGCACAAGGGTTAAAAAAGG - Intronic
994782363 5:104107456-104107478 TAGAGCAAATATTTTAAAAATGG - Intergenic
994834839 5:104836138-104836160 TATAGCACAAATTGTAAAAAGGG - Intergenic
995346875 5:111131633-111131655 TAGAGAAAAAAGGTTAACATCGG - Intergenic
996201108 5:120674769-120674791 TAGAGCAAAAAGATCAATATTGG - Intronic
998035087 5:138908263-138908285 TATAGGGCAAACTTTAAAATGGG - Intronic
999909611 5:156183301-156183323 AAAAGCAAAAAGTTGAAAATAGG + Intronic
1001172188 5:169430130-169430152 TAGAGAAGAAAGAATAAAATAGG + Intergenic
1003820364 6:9889480-9889502 AAGGGTACAAAGTTTCAAATAGG + Intronic
1005010485 6:21330916-21330938 TGGAGCACAGAATTTAACATAGG + Intergenic
1006229042 6:32566486-32566508 CAGAGCAGAAAGATTAAAACAGG - Intronic
1006655299 6:35586816-35586838 TAGAGCAGAATGTGTAAAAGAGG + Intronic
1008601101 6:53096159-53096181 TAGAACAAAGAGTTTTAAATAGG - Intronic
1009898792 6:69785660-69785682 TAGAGAAAAATGATTAAAATTGG - Intronic
1010336348 6:74688396-74688418 TTGATTACAAAGTTTCAAATAGG - Intergenic
1010546269 6:77160373-77160395 TAGAAAACAAAGTTAAAAAATGG - Intergenic
1010708365 6:79141583-79141605 GAGAGCACAAAAGTAAAAATCGG + Intergenic
1011256741 6:85430240-85430262 TAAAGGACAAGCTTTAAAATAGG - Intergenic
1011465938 6:87657025-87657047 TAGAGCACAAACTGAAAAAAGGG - Intronic
1012917295 6:105183961-105183983 TAGAGCAAAAATTTTAAAGTTGG - Intergenic
1013285173 6:108675130-108675152 TAGATCAGATAGTTTAAGATAGG + Intronic
1013730981 6:113166824-113166846 TATAGCACATAGTTAAAAATGGG - Intergenic
1014481499 6:121943970-121943992 TAGAGCACACAGGTTACAAAAGG + Intergenic
1015359274 6:132319122-132319144 AAGAGCAAAAGGTTAAAAATAGG - Intronic
1016447394 6:144148041-144148063 TAAAGGACAAAGATTAAAACAGG - Intergenic
1017314085 6:153009058-153009080 TAGAACACAGATTTTAAAGTTGG - Exonic
1017958288 6:159198465-159198487 CAGAGCAGAAAGTTTATAAAAGG + Intronic
1018362199 6:163082736-163082758 TAGAAAAAATAGTTTAAAATAGG - Intronic
1018519242 6:164627073-164627095 TAGAGCACAAATATAAAAATGGG + Intergenic
1019141920 6:169953509-169953531 CAGAGCATAAAGTTGGAAATAGG - Intergenic
1020288510 7:6705072-6705094 AAGGGTTCAAAGTTTAAAATGGG - Intronic
1020518572 7:9157063-9157085 TAATGCACAAAGTTTATAAGTGG + Intergenic
1020971714 7:14951639-14951661 TAAAGCACATAGTTTACATTGGG - Intronic
1021046351 7:15927384-15927406 AAAAGCAAAAAGTTTAAAAGTGG + Intergenic
1021247659 7:18283509-18283531 TAAAGCAGAAAGTTTAACAGTGG + Intronic
1021258918 7:18429700-18429722 CAAAGCATAAAGTTTAAACTTGG + Intronic
1021942854 7:25696523-25696545 TAGGGCAAGAAGTTTGAAATGGG - Intergenic
1022733171 7:33051060-33051082 AAGAGAATAAAGATTAAAATAGG + Intronic
1023272839 7:38483683-38483705 TAGTCCACAAAGATTAAAAGAGG + Intronic
1023291586 7:38673682-38673704 TTAAGCACAAAGTATAAAAACGG - Intergenic
1024100343 7:46026231-46026253 TAGAGCATAAATCATAAAATTGG - Intergenic
1025771050 7:64507319-64507341 AAGGGTACAAAGTTTCAAATAGG + Intergenic
1027504294 7:78996285-78996307 TAGACCACAAAGTTAACATTAGG - Intronic
1028042328 7:86069528-86069550 TAAAACAGAAAGTATAAAATAGG + Intergenic
1028059236 7:86289323-86289345 TATAATACAATGTTTAAAATAGG + Intergenic
1030452160 7:109725370-109725392 TATTGAACAAAGTATAAAATTGG + Intergenic
1030919547 7:115364753-115364775 TAGAGCAGAAATAATAAAATAGG - Intergenic
1031293826 7:119976357-119976379 TACATCACAAAGATTAAATTAGG + Intergenic
1031386635 7:121159904-121159926 TAGATCATAACTTTTAAAATAGG - Intronic
1032328481 7:130954855-130954877 AAGAGAACAGAGTTTAAAATTGG + Intergenic
1032448692 7:132007633-132007655 TAGAACAGAAAGTTCAAAACTGG - Intergenic
1033867101 7:145703596-145703618 TAGAACAGAAATTTTAAAAAAGG - Intergenic
1035694516 8:1585011-1585033 TAAAGCACAAAATTTAAAAATGG - Intronic
1036705942 8:11047024-11047046 AAGGGCACAAAGTTTCAATTCGG + Intronic
1037167410 8:15847644-15847666 AAGATCACAAAGCTTAAAAATGG - Intergenic
1039322036 8:36442911-36442933 TAGAGCATAAAATTCAATATAGG - Intergenic
1040504167 8:48032293-48032315 TAGAGGCTAAAGTTGAAAATTGG + Intronic
1041159498 8:55024880-55024902 TAGAGCACAAGGTCAAAACTAGG - Intergenic
1042911282 8:73829350-73829372 GAGAGGAAAAAGATTAAAATGGG + Intronic
1043068583 8:75609256-75609278 TAGAGCAAAAAGTTTCAGATTGG + Intergenic
1043074299 8:75676736-75676758 TAAAGTATAAAGTTTATAATAGG + Intergenic
1043190881 8:77221588-77221610 CAGAGCAAAAATTTTAAAATGGG + Intergenic
1044554794 8:93551347-93551369 TAGAGCACAAAATTTCAGATAGG + Intergenic
1045290462 8:100828269-100828291 TAGTCCTCAATGTTTAAAATTGG + Intergenic
1045493919 8:102692125-102692147 TAAAGGACAAAATTTAAAAAAGG - Intergenic
1045600813 8:103713467-103713489 TAGATGACAAAGTGGAAAATAGG - Intronic
1045871789 8:106935254-106935276 TAGAGGACCCAGTTCAAAATGGG + Intergenic
1046004894 8:108467100-108467122 TACATCACAAATTTTACAATTGG - Intronic
1046832896 8:118765881-118765903 GAGAATACAAAGTTGAAAATAGG - Intergenic
1046901780 8:119531189-119531211 TACAGCATAAATATTAAAATGGG - Intergenic
1047108811 8:121765839-121765861 TGGAGCACCTAGTTTAGAATGGG - Intergenic
1047755571 8:127915739-127915761 TAGAGCACACAGTGTAGAAGTGG + Intergenic
1047954876 8:129966560-129966582 CAGAGATCAAAGTTTAAAAAAGG + Intronic
1048164666 8:132051935-132051957 TTGAGCCAAGAGTTTAAAATTGG - Intronic
1050058275 9:1678350-1678372 GAGAGCCCAAAGTAGAAAATAGG - Intergenic
1050101268 9:2122620-2122642 TTGACCACTAATTTTAAAATAGG + Intronic
1050607680 9:7318160-7318182 TAAAACACAAAGCTGAAAATGGG + Intergenic
1050698027 9:8300944-8300966 GATAGCTCAAAGTTTCAAATGGG - Intergenic
1050719346 9:8567639-8567661 AAGAGCACACAGTCTAGAATAGG - Intronic
1050767984 9:9159759-9159781 TTGAGCAAAAAGAATAAAATAGG + Intronic
1051581534 9:18680975-18680997 AATAGCACAAAAATTAAAATTGG + Intronic
1051630005 9:19132201-19132223 TAGAGCTTAAAGTTTAAGATAGG - Intronic
1051754428 9:20382102-20382124 TAGAGAAAAAGTTTTAAAATAGG - Intronic
1052050362 9:23840556-23840578 TATAACACAAAGTATAAAATTGG - Intergenic
1052871102 9:33507482-33507504 GAGAGCAAGAATTTTAAAATCGG - Intergenic
1053278832 9:36803288-36803310 TGGAGCACAGACTTTAAAATAGG + Intergenic
1053657555 9:40233934-40233956 AACAGCACATATTTTAAAATTGG + Intronic
1053720421 9:40940422-40940444 TAGAGCCCACAGTTGAACATTGG + Intergenic
1053907917 9:42863211-42863233 AACAGCACATATTTTAAAATTGG + Intergenic
1054345561 9:63911709-63911731 TAGAGCCCACAGTTGAACATTGG - Intergenic
1054369679 9:64380205-64380227 AACAGCACATATTTTAAAATTGG + Intronic
1054527041 9:66142294-66142316 AACAGCACATATTTTAAAATTGG - Intronic
1054677306 9:67869958-67869980 AACAGCACATATTTTAAAATTGG + Intronic
1055018099 9:71640859-71640881 TAGAGTAAAAAATATAAAATGGG + Intergenic
1055082980 9:72285440-72285462 TAAATCACTAATTTTAAAATAGG - Intergenic
1055251549 9:74313827-74313849 TAGAGTAGAAAGTCCAAAATAGG + Intergenic
1055273439 9:74587415-74587437 TAGAGAACAATATATAAAATAGG - Intronic
1056152985 9:83805766-83805788 CATTGCATAAAGTTTAAAATAGG - Intronic
1057687415 9:97247860-97247882 GAGAGCAAGAATTTTAAAATCGG + Intergenic
1058044960 9:100348497-100348519 TACAGCACATAGTTTATTATAGG - Intronic
1058059643 9:100481632-100481654 TAGAAAACAAAGTCTGAAATTGG + Intronic
1058191513 9:101922373-101922395 AGAAGCACAAAGCTTAAAATTGG + Intergenic
1059077138 9:111205352-111205374 AAGAGCAAAAATTTAAAAATGGG + Intergenic
1059275601 9:113094212-113094234 TAGAGCCCATAGTTTACATTAGG - Intergenic
1059662233 9:116413355-116413377 TAAAGAACAAAGTTTAAGCTAGG + Intergenic
1060795898 9:126513151-126513173 TAGAGGAAAAGGTTGAAAATTGG - Intergenic
1203610841 Un_KI270749v1:1455-1477 TAGAGAACAAATATTCAAATTGG - Intergenic
1185974033 X:4698156-4698178 TAGTGCACACATATTAAAATGGG - Intergenic
1186174813 X:6914814-6914836 GAGAGCACAAAGTAAAGAATTGG - Intergenic
1188138430 X:26518747-26518769 AAAAGCAAAAATTTTAAAATGGG - Intergenic
1189419798 X:40846755-40846777 TAGAGCAGAAAGATTTAATTTGG + Intergenic
1190186760 X:48241850-48241872 CAGAGCACAAGTTTTAAATTGGG - Intronic
1191829309 X:65398739-65398761 TAGAGAACTAACTTAAAAATGGG - Intronic
1193415902 X:81223679-81223701 TAAAACACTAATTTTAAAATTGG - Intronic
1193845196 X:86461006-86461028 TATTTCACAAAGTTAAAAATAGG - Intronic
1194111923 X:89844653-89844675 CAGAGCAAATATTTTAAAATAGG + Intergenic
1194359561 X:92932677-92932699 CAGAGTACATAGTTTAAATTAGG - Intergenic
1196140575 X:112258269-112258291 TAAAGCCCATAGTTTACAATAGG - Intergenic
1197467460 X:126821697-126821719 TAGGGTACAAGGTTTCAAATAGG - Exonic
1197475136 X:126913760-126913782 TAAAGCAAAAATTTAAAAATAGG + Intergenic
1198222047 X:134611372-134611394 TAGTGCACAGATTTAAAAATAGG - Intronic
1198373095 X:136011037-136011059 TAGAGCACAAAGTTTAAAATCGG - Intronic
1198601893 X:138293164-138293186 GAGAGTACAACGTTTAAAAGTGG - Intergenic
1198795791 X:140392537-140392559 AAGAGCACAGGATTTAAAATTGG + Intergenic
1199179611 X:144838413-144838435 CTGACCACAAAGTTTAAGATAGG + Intergenic
1200464580 Y:3499439-3499461 CAGAGCAAATATTTTAAAATAGG + Intergenic
1200667761 Y:6048509-6048531 CAGAGTACATAGTTTAAATTAGG - Intergenic