ID: 1198374767

View in Genome Browser
Species Human (GRCh38)
Location X:136027722-136027744
Sequence GTTCCACAAGACTATACATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198374767_1198374774 23 Left 1198374767 X:136027722-136027744 CCTAATGTATAGTCTTGTGGAAC No data
Right 1198374774 X:136027768-136027790 AATACAATTGGAAATCCTGGAGG No data
1198374767_1198374772 11 Left 1198374767 X:136027722-136027744 CCTAATGTATAGTCTTGTGGAAC No data
Right 1198374772 X:136027756-136027778 TTTGGATTTTAAAATACAATTGG No data
1198374767_1198374773 20 Left 1198374767 X:136027722-136027744 CCTAATGTATAGTCTTGTGGAAC No data
Right 1198374773 X:136027765-136027787 TAAAATACAATTGGAAATCCTGG No data
1198374767_1198374771 -7 Left 1198374767 X:136027722-136027744 CCTAATGTATAGTCTTGTGGAAC No data
Right 1198374771 X:136027738-136027760 GTGGAACATGGTAAGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198374767 Original CRISPR GTTCCACAAGACTATACATT AGG (reversed) Intronic