ID: 1198376232

View in Genome Browser
Species Human (GRCh38)
Location X:136042597-136042619
Sequence CCTCGAGGACTGCAGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198376232_1198376237 -7 Left 1198376232 X:136042597-136042619 CCTCCTACCTGCAGTCCTCGAGG 0: 1
1: 0
2: 0
3: 8
4: 181
Right 1198376237 X:136042613-136042635 CTCGAGGCAGTCTTTATTATAGG 0: 1
1: 0
2: 0
3: 4
4: 51
1198376232_1198376238 3 Left 1198376232 X:136042597-136042619 CCTCCTACCTGCAGTCCTCGAGG 0: 1
1: 0
2: 0
3: 8
4: 181
Right 1198376238 X:136042623-136042645 TCTTTATTATAGGCTCACTGTGG 0: 1
1: 0
2: 0
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198376232 Original CRISPR CCTCGAGGACTGCAGGTAGG AGG (reversed) Intronic
900633938 1:3652627-3652649 CTGCGACGGCTGCAGGTAGGAGG + Exonic
901786595 1:11629082-11629104 CTTCGATGACTTCAGGTTGGTGG - Intergenic
901791230 1:11654644-11654666 CCTGGGGGACTGCTGGGAGGAGG + Exonic
902375867 1:16029717-16029739 CATCCAGAACTGCAGGAAGGGGG - Exonic
903222855 1:21878543-21878565 CCTTGGGGGCTGCAGGAAGGGGG - Intronic
903480886 1:23652470-23652492 CCGGGAGGACTGAAGGGAGGAGG + Intergenic
903647204 1:24902666-24902688 CCTGGAGGACAGCAGGGAAGAGG + Exonic
903662100 1:24984505-24984527 CCTGGAGGGCTGCATGGAGGTGG + Intergenic
903710742 1:25322234-25322256 CGCTGAGGACTGCAGATAGGGGG - Intronic
904754048 1:32758406-32758428 CCTCCAGGTCTACAGGCAGGGGG - Intronic
906125485 1:43424681-43424703 CCTTGAGGACTGCTGGGAGGTGG + Intronic
907194418 1:52675005-52675027 CCAGGAGCACTGCAGGTCGGGGG + Intergenic
908014275 1:59815052-59815074 CCTGGAGGAGAGCCGGTAGGAGG + Exonic
915127794 1:153678332-153678354 CCCCGAGGAGACCAGGTAGGAGG + Intergenic
917967703 1:180188900-180188922 CCACAAGGACTCCAGGGAGGAGG - Intronic
918080989 1:181207508-181207530 GCTTGAGCACTGCAGGGAGGCGG - Intergenic
919879992 1:201894994-201895016 CCTAGAGGGCTGGAGGAAGGAGG + Intergenic
920171257 1:204073634-204073656 CCGCGAGGACCGCACGGAGGAGG + Exonic
922800108 1:228361294-228361316 CCCTGAGGGCTGCAGGTAGAGGG - Intronic
923157755 1:231293463-231293485 GGTCGGGGACTGCAGGTGGGAGG - Intergenic
924626772 1:245702178-245702200 CCTCCATGGCTGGAGGTAGGGGG + Intronic
1062824537 10:557944-557966 CCTGGAGGGCTGGAGGCAGGAGG + Intronic
1063043774 10:2371622-2371644 TCTGGAGGACTGCTGGTCGGGGG - Intergenic
1063043782 10:2371660-2371682 TCTGGAGGACTGCTGGTCGGGGG - Intergenic
1063043797 10:2371736-2371758 TCTGGAGGACTGCTGGTCGGGGG - Intergenic
1063043818 10:2371851-2371873 TCTGGAGGACTGCCGGTCGGGGG - Intergenic
1063043870 10:2372113-2372135 TCTGGAGGACTGCTGGTTGGGGG - Intergenic
1063455494 10:6179611-6179633 CCAGGAGGACTGCAGGCAAGAGG + Intronic
1064408360 10:15084253-15084275 CCTCACGGACTGCTGGTGGGTGG + Intronic
1067060080 10:43073786-43073808 CCTCGTGACTTGCAGGTAGGGGG - Intergenic
1067067340 10:43111403-43111425 CCTAGAGGTCTGCTGGTCGGTGG - Exonic
1067453403 10:46396603-46396625 CCTCATGGACTGCAGGTCAGGGG - Intergenic
1067583832 10:47463163-47463185 CCTCATGGACTGCAGGTCAGGGG + Intronic
1067633835 10:47988511-47988533 CCTCATGGACTGCAGGTCAGGGG + Intergenic
1070157791 10:73846929-73846951 CCTTGTGGACTCCAGGTAGCCGG - Intronic
1073621560 10:105054696-105054718 CCTCGAGGTCTCAAGGTTGGTGG + Intronic
1074668820 10:115763972-115763994 CCTCTAGGAAGGCAAGTAGGTGG - Intronic
1077504556 11:2924064-2924086 CCCCCAGGACTCCAGGTGGGAGG - Intronic
1079851231 11:25537582-25537604 CCTAGAGGACTGGACTTAGGAGG + Intergenic
1080161585 11:29182932-29182954 TATCAGGGACTGCAGGTAGGGGG + Intergenic
1082784080 11:57307313-57307335 CATTGAGGACTGCAGGGACGAGG - Intronic
1082833778 11:57638217-57638239 CCTCGCGGACTGTTGGGAGGCGG + Intergenic
1083436348 11:62646229-62646251 CCCCGCGCACTGCAGGAAGGGGG + Intronic
1084227874 11:67728720-67728742 CCTGGAGGACTGTGGGTAGAAGG - Intergenic
1084847289 11:71910610-71910632 CCTGGAGGACTGTGGGTAGAAGG + Intronic
1085293966 11:75420330-75420352 CCTAGAGGCCTGCAGCTAGATGG - Intronic
1085444374 11:76590624-76590646 CCTGGAGGCCTGCAGGTACATGG + Intergenic
1087202174 11:95356850-95356872 CCTCTAGGAATGCAGGTACATGG - Intergenic
1088797427 11:113275176-113275198 CCTTGGGGACAGCAGGGAGGAGG - Intronic
1090837321 11:130462802-130462824 GCTCGGGGACTGCTGGGAGGAGG + Intronic
1092432554 12:8420971-8420993 CCTGGAGGACTGTGGGTAGAAGG - Intergenic
1094513957 12:31117419-31117441 CCTGGAGGACTGTGGGTATGGGG + Intergenic
1095989099 12:48021977-48021999 CCTCAGGGGCTGCAGGAAGGAGG - Intronic
1096578241 12:52568161-52568183 GGGCGAGGAGTGCAGGTAGGTGG - Exonic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1100403993 12:94257205-94257227 CCTCTAGGCCTGGAGGTTGGGGG + Intronic
1102261341 12:111445230-111445252 CCTTAAGGCCTGCAGCTAGGGGG + Intronic
1102655486 12:114479551-114479573 CATCGTGGGCTGCAGGTAAGAGG - Intergenic
1102951418 12:117033931-117033953 CCTCGTTAACTGCAGGCAGGTGG + Intergenic
1104460178 12:128949055-128949077 CCCCGAGGACTGCAGTTGGGAGG - Intronic
1104479691 12:129096617-129096639 CCTCAAGGAGTGCTGGTAGCAGG - Intronic
1110315443 13:74101138-74101160 CCTCGTGGCTTGCAGGGAGGTGG - Intronic
1116633960 14:47369536-47369558 GCTGGAGGACTGCAGGGTGGAGG - Intronic
1119787403 14:77323813-77323835 CCCGGAGGACTGCTGGGAGGTGG + Intronic
1120697071 14:87656698-87656720 GCTGGAGGCCTGCAGGTAGGAGG + Intergenic
1121858938 14:97298504-97298526 CCCCGAGTCCTGCAGCTAGGGGG - Intergenic
1122053068 14:99073416-99073438 CCTGGAGGCATGCAGGTAGTAGG + Intergenic
1122127939 14:99589225-99589247 CCCTGAGGACAGCAGGCAGGGGG + Intronic
1122738976 14:103859884-103859906 CCCAGGGGACTGCAGGGAGGTGG - Intergenic
1124353642 15:28978756-28978778 TCTCCAGGACTGCAGGAGGGTGG + Intronic
1124846047 15:33291457-33291479 CCTCTAACACTGCAGGTAGTCGG - Intergenic
1125540121 15:40465421-40465443 TGCCGAGTACTGCAGGTAGGTGG + Exonic
1129685298 15:77682717-77682739 GCTGGGGGACTGCAGGCAGGAGG - Intronic
1132943373 16:2519432-2519454 GCTGGAGGACTGCAGGGAGGGGG + Intronic
1133336730 16:5011259-5011281 CTCTGAGGACTTCAGGTAGGAGG + Exonic
1133492545 16:6284469-6284491 CCTGCAGAACTGCAGGTGGGTGG + Intronic
1133849128 16:9485526-9485548 CCTCGAGCACTGCAGCAAGGAGG + Intergenic
1134328116 16:13225662-13225684 CCTCAAGGAAAGGAGGTAGGTGG + Intronic
1137669229 16:50269664-50269686 CCTCCAGGACAGCAGGAGGGAGG - Intronic
1138502638 16:57457290-57457312 CCACCAGGTCTGCAGGGAGGAGG + Intronic
1138550787 16:57747237-57747259 TCTCCAGGGCTTCAGGTAGGTGG - Intronic
1139952686 16:70679816-70679838 CATCGAGGACTGGAAGAAGGCGG - Exonic
1142608356 17:1094784-1094806 CCTGGAGGGCTGCATGGAGGAGG + Intronic
1143469759 17:7165227-7165249 CCTCCAGGACCGCAGGGAGAGGG - Intergenic
1144623875 17:16834575-16834597 CACCGAGGACTGGAGGGAGGAGG + Intergenic
1144882554 17:18438141-18438163 CACCGAGGACTGGAGGGAGGAGG - Intergenic
1145149680 17:20506245-20506267 CACCGAGGACTGGAGGGAGGAGG + Intergenic
1146616003 17:34357888-34357910 CCTCCAGGACAGGAAGTAGGAGG - Intronic
1147670109 17:42171987-42172009 CAGCGAGGTCTGCAGGAAGGTGG + Exonic
1147879070 17:43642332-43642354 CCTTGGGGAATGGAGGTAGGGGG - Intronic
1157616752 18:48991686-48991708 CCTCGAGGACCGGAGGGAGAAGG + Intergenic
1158024386 18:52878460-52878482 CCTTGGGGACTGCATGTAGGTGG - Intronic
1165132644 19:33642194-33642216 CCTCTGGGACTGCAGATGGGTGG + Intronic
925913645 2:8589023-8589045 CCTGGAGGACTGCAGTCAGAGGG + Intergenic
927872376 2:26631778-26631800 CCAGGAGGACTGGAGGTATGAGG + Intronic
929992358 2:46800965-46800987 CCCCGGGGCTTGCAGGTAGGAGG + Intergenic
932054396 2:68429955-68429977 CTTGGAGGACTTCAGGTTGGTGG + Intergenic
932066280 2:68565326-68565348 CAGCTAGGACTGCAGGTATGGGG - Intronic
932412592 2:71556057-71556079 CATCGCAGGCTGCAGGTAGGGGG + Exonic
932823326 2:74919897-74919919 CCTCGAGATCTGCATTTAGGAGG - Intergenic
936037284 2:109123093-109123115 CATGGAAGACTGCAGGGAGGAGG + Intergenic
938064199 2:128272232-128272254 CGTCACGGTCTGCAGGTAGGAGG + Intronic
946372932 2:219291462-219291484 CATCGTGCACTGCAGGTGGGTGG - Exonic
947527168 2:230885837-230885859 CCTCGAGGGCTGGAGGGAAGTGG - Intergenic
948593997 2:239067900-239067922 CCTCGGGGACTCCAGGGTGGGGG + Intronic
1169132763 20:3174402-3174424 CCGGGAGGACTGCCGGGAGGAGG + Intergenic
1169806548 20:9566097-9566119 CCTGGAGGGCTGCTGGTCGGAGG + Exonic
1170607000 20:17882196-17882218 CCTGGAGGGCTGCTTGTAGGAGG + Intergenic
1173082004 20:39877402-39877424 CCTGGAGGCCTGCAGGGAGCGGG + Intergenic
1174180077 20:48669040-48669062 CCCAGAGGGCTGCAGGGAGGTGG - Intronic
1174199150 20:48794735-48794757 CCCCGAGGACTGTAGGCAGCCGG - Intronic
1174745508 20:53057988-53058010 TTTCTAGGACTGGAGGTAGGGGG + Intronic
1175485029 20:59339639-59339661 TCTCGAGGAGTGCAGATAGCAGG - Intergenic
1175621935 20:60454719-60454741 CCTCCAGGAGTGGAAGTAGGTGG - Intergenic
1175995963 20:62812524-62812546 GCTCGAGGGCTCCAGGAAGGTGG + Exonic
1177001194 21:15615215-15615237 TCTGGGGAACTGCAGGTAGGGGG + Intergenic
1177816192 21:25979835-25979857 CCACGATGAATGCAGGTAGCAGG + Intronic
1180143273 21:45905938-45905960 CCACTAAGGCTGCAGGTAGGTGG + Intronic
1180937307 22:19634202-19634224 CCTCCAGGACTGCAAGGAGTAGG + Intergenic
1182452993 22:30432363-30432385 CCTGGAGGTCTGCAGGAAGAGGG + Intergenic
1183474274 22:38027222-38027244 CTCTGAGGCCTGCAGGTAGGAGG - Intronic
1184411240 22:44327660-44327682 CCTGGAGGAAGGCAGGAAGGAGG + Intergenic
950727132 3:14923766-14923788 CCTCCAGGCCTCCAGGTAGCAGG - Intronic
952897039 3:38084713-38084735 CCTCAAGGACTGCTGATGGGGGG - Intronic
960511139 3:118550812-118550834 CCCCCAAGACTGAAGGTAGGAGG - Intergenic
961274955 3:125719208-125719230 CCTGGAGGACTGTGGGTAGAAGG + Intergenic
961277872 3:125741839-125741861 CCTGGAGGACTGTGGGTAGAAGG + Intergenic
961562490 3:127740387-127740409 GCTCTAGGACTTCATGTAGGTGG + Intronic
961876549 3:130027823-130027845 CCTGGAGGACTGTGGGTAGAAGG - Intergenic
963121191 3:141778325-141778347 CTTCCGGGCCTGCAGGTAGGCGG - Exonic
966881840 3:184354965-184354987 CATCCAGAACTGCAGGCAGGGGG + Exonic
968519394 4:1028836-1028858 CTTCGAGGACTTGAGGCAGGAGG + Intergenic
969729317 4:8944493-8944515 CCTGGAGGACTGTGGGTAGAAGG + Intergenic
969785490 4:9454027-9454049 CCTGGAGGACTGTGGGTAGAAGG + Intergenic
969826542 4:9762567-9762589 CCTGGAGGACTGTGGGTAGAAGG + Intergenic
983263206 4:165478938-165478960 CATTGAGGACTTCAGGAAGGAGG - Intronic
985660752 5:1155627-1155649 CCTCGAGGGGCGCAGGTGGGCGG - Intergenic
985925575 5:3013769-3013791 CCTTGAGGACTGCAGGGTGATGG + Intergenic
986238713 5:5937547-5937569 CCTCAAGCACTCCAGGCAGGAGG - Intergenic
1000151186 5:158502798-158502820 CCACCAGGACTGCTGGGAGGTGG - Intergenic
1007340870 6:41190966-41190988 CCTGGGGGACAGCAGGGAGGAGG - Exonic
1018344957 6:162890916-162890938 CCTCGAGGGGTGCAGCTGGGTGG - Intronic
1018747037 6:166770396-166770418 CCTCGAGGTTTGCAGGCTGGTGG - Intronic
1018786059 6:167108768-167108790 CCTCGAGGGCTGCAGGGTGGGGG + Intergenic
1020311673 7:6873141-6873163 CCTGGAGGACTGTGGGTAGAAGG - Intergenic
1021909295 7:25368402-25368424 CTTCGAGAACAGAAGGTAGGAGG - Intergenic
1022467034 7:30658932-30658954 CCTCGAGGACAACAGGCAGATGG + Intronic
1028290230 7:89056532-89056554 CATCTAGGACTGGAGGCAGGAGG - Intronic
1032467485 7:132155365-132155387 CCTTGAGGAGTGAAGGGAGGAGG + Intronic
1033249343 7:139745500-139745522 CCTCGAGGACTCTAAGTTGGGGG + Intronic
1034131485 7:148722500-148722522 CCTGGAGGCCTGCAGGATGGCGG - Intronic
1034305059 7:150040694-150040716 CCTGGAGGACTGTGGGTATGAGG - Intergenic
1034305691 7:150043218-150043240 CCTGGAGGACTGTGGGTATGAGG - Intergenic
1034309144 7:150071654-150071676 CCTCGAGGACAGAGGGGAGGTGG + Intergenic
1034340603 7:150352030-150352052 ACTGGAGGACTACAGGGAGGAGG + Intergenic
1034797711 7:154028982-154029004 CCTCGAGGACAGAGGGGAGGTGG - Intronic
1034801153 7:154057432-154057454 CCTGGAGGACTGTGGGTATGAGG + Intronic
1034801466 7:154058660-154058682 CCTGGAGGACTGCGGGTGGTAGG + Intronic
1034982616 7:155488565-155488587 CCTCCAGGTGTGCAGGAAGGCGG + Intronic
1035400072 7:158558964-158558986 CCCCGAGGTCTGCAGGCAGCAGG + Intronic
1036262207 8:7249888-7249910 CCTGGAGGACTGTGGGTAGAAGG - Intergenic
1036304381 8:7589670-7589692 CCTGGAGGACTGTGGGTAGAAGG + Intergenic
1036314246 8:7708427-7708449 CCTGGAGGACTGTGGGTAGAAGG - Intergenic
1036355233 8:8037662-8037684 CCTGGAGGACTGTGGGTAGAAGG + Intergenic
1036833498 8:12039886-12039908 CCTGGAGGACTGTGGGTAGAAGG - Intergenic
1036855344 8:12286451-12286473 CCTGGAGGACTGTGGGTAGAAGG - Intergenic
1036903659 8:12690303-12690325 CCTGGAGGACTGTGGGTAGAAGG - Intergenic
1036906145 8:12709936-12709958 CCTGGAGGACTGTGGGTAGAAGG - Intergenic
1039464675 8:37776044-37776066 CCTCGAGGGGTGGGGGTAGGGGG + Intronic
1039790526 8:40872404-40872426 CCCCGAGGCCTACAGGGAGGGGG - Intronic
1039840448 8:41289238-41289260 CCTCCAGCTCTGCAGTTAGGTGG - Intronic
1046419378 8:113959638-113959660 CCTGGTGTACTGCAGGAAGGAGG - Intergenic
1047313343 8:123710611-123710633 CCTCCAGGACTGCAGCCATGTGG + Intronic
1048301507 8:133254700-133254722 CCTTGAGGCCTGCATGTAGGGGG - Intronic
1049621311 8:143599526-143599548 GCCCGAGGGCTGCAGGGAGGAGG + Exonic
1053283612 9:36837006-36837028 CCTAGGGGCCTGCAGGTTGGCGG - Exonic
1055979813 9:81990783-81990805 CCCCGAGGACTGCAGGAAACAGG - Exonic
1057029439 9:91763168-91763190 ACGGGAGGACTGAAGGTAGGAGG + Intronic
1060252301 9:121996115-121996137 ACTCGAGGAGTGCATGCAGGGGG - Intronic
1060943394 9:127556194-127556216 CTTCGAGGAATACAGGCAGGAGG + Intronic
1061242923 9:129384645-129384667 CATTGAGGACTGCGGGTGGGTGG - Intergenic
1062114518 9:134800937-134800959 CCTCGAGGCCTCCGGGTAGAAGG + Intronic
1062645344 9:137545081-137545103 CCTTCAGGAGTGCAGGGAGGCGG + Intronic
1187002001 X:15191362-15191384 CCTCGACAACTGCGGGCAGGAGG - Intergenic
1198376232 X:136042597-136042619 CCTCGAGGACTGCAGGTAGGAGG - Intronic
1200120309 X:153787110-153787132 CCTCCAGTGCTGCAGGGAGGTGG - Exonic
1200699126 Y:6386995-6387017 CCTGGGGGACTGCGGGTATGAGG + Intergenic
1200948073 Y:8865681-8865703 CCTGGAGGACTGTAGGTATAAGG + Intergenic
1201034986 Y:9777704-9777726 CCTGGGGGACTGCGGGTATGAGG - Intergenic
1201941685 Y:19466977-19466999 CCTTGAGAAAAGCAGGTAGGTGG + Intergenic