ID: 1198377352

View in Genome Browser
Species Human (GRCh38)
Location X:136052976-136052998
Sequence CTAAAATCAAGGGGACGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198377352_1198377363 22 Left 1198377352 X:136052976-136052998 CCCCACCGTCCCCTTGATTTTAG No data
Right 1198377363 X:136053021-136053043 TTCTGACCTACAGAACCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198377352 Original CRISPR CTAAAATCAAGGGGACGGTG GGG (reversed) Intergenic
No off target data available for this crispr