ID: 1198385895

View in Genome Browser
Species Human (GRCh38)
Location X:136129160-136129182
Sequence GAAACCACCTCCAAGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198385883_1198385895 27 Left 1198385883 X:136129110-136129132 CCCTGATCTGAGCTTTTGCTAAC No data
Right 1198385895 X:136129160-136129182 GAAACCACCTCCAAGGGGATGGG No data
1198385884_1198385895 26 Left 1198385884 X:136129111-136129133 CCTGATCTGAGCTTTTGCTAACT No data
Right 1198385895 X:136129160-136129182 GAAACCACCTCCAAGGGGATGGG No data
1198385889_1198385895 -4 Left 1198385889 X:136129141-136129163 CCAGGACTGGGAGAACCGAGAAA No data
Right 1198385895 X:136129160-136129182 GAAACCACCTCCAAGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198385895 Original CRISPR GAAACCACCTCCAAGGGGAT GGG Intergenic
No off target data available for this crispr