ID: 1198389612

View in Genome Browser
Species Human (GRCh38)
Location X:136161082-136161104
Sequence GAACCCAGCCTGTCTATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198389612_1198389616 26 Left 1198389612 X:136161082-136161104 CCAGATATAGACAGGCTGGGTTC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1198389616 X:136161131-136161153 CCCTAACTACTGTGAGTATCTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1198389612_1198389618 30 Left 1198389612 X:136161082-136161104 CCAGATATAGACAGGCTGGGTTC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1198389618 X:136161135-136161157 AACTACTGTGAGTATCTGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198389612 Original CRISPR GAACCCAGCCTGTCTATATC TGG (reversed) Intronic
900683367 1:3931334-3931356 GAACCCAGCCTGCCCAACTCTGG + Intergenic
904107125 1:28094678-28094700 GAACCCAGCCTTTCAGTGTCAGG - Intergenic
904884427 1:33725632-33725654 GATCCCAGCCTGCCAAAATCTGG - Intronic
906699698 1:47848970-47848992 CAACCCTTCCTGTCTATATGTGG + Intronic
906844233 1:49173404-49173426 GAACCCAGTCTATCTGTATCTGG + Intronic
907582648 1:55585738-55585760 GAACACAGCCAAACTATATCAGG + Intergenic
915848887 1:159299689-159299711 ATACCCAGCCTGTCCACATCAGG - Intronic
916726666 1:167529657-167529679 GAACTCAGCCATGCTATATCAGG - Intronic
920933054 1:210406862-210406884 AAACCCAGAGTGTCTATACCTGG - Intronic
923495282 1:234519366-234519388 GAACCCAACCTTTCTCTCTCAGG - Intergenic
924330395 1:242935581-242935603 GAACCCAGGCTGTCTGATTCTGG + Intergenic
1063706167 10:8433046-8433068 GAACCCTGCCAGTTTATATCAGG + Intergenic
1064540288 10:16398175-16398197 AAATCCAACCTGTCTAGATCAGG + Intergenic
1065009419 10:21408068-21408090 GAGCCCAGCCCTTCTGTATCAGG + Intergenic
1068943150 10:62701282-62701304 GAACCCAGGCAGTCTATCTCTGG - Intergenic
1074821890 10:117185884-117185906 GAACCCTGCCTGTGTTTATTAGG - Intergenic
1075905801 10:126081074-126081096 GAATCCAGCCTGATTATAGCTGG - Intronic
1075991328 10:126841304-126841326 GGCCCCAGCCTGTCTAGAGCAGG + Intergenic
1085702661 11:78758808-78758830 GACCCCAGACAGTCTATCTCTGG - Intronic
1087887189 11:103494725-103494747 GAGCCCAGCCCTTCTGTATCAGG - Intergenic
1098680004 12:73341584-73341606 GGACCCAGACTGACTATATTTGG + Intergenic
1100165416 12:91912111-91912133 GAAGCCAGCCTCTCTATCTTTGG + Intergenic
1101356259 12:103980250-103980272 GAACCCAGACAGTCTAAATTTGG - Intronic
1104265342 12:127227034-127227056 GAACACAGCATATCTATCTCAGG + Intergenic
1104469448 12:129017962-129017984 GAGCCCAGCCCTTCTGTATCAGG - Intergenic
1104469463 12:129018041-129018063 GAGCCCAGCCCTTCTGTATCAGG - Intergenic
1104469477 12:129018118-129018140 GAGCCCAGCCCTTCTGTATCAGG - Intergenic
1104469492 12:129018197-129018219 GAGCCCAGCCCTTCTGTATCAGG - Intergenic
1104469507 12:129018276-129018298 GAGCCCAGCCCTTCTGTATCAGG - Intergenic
1104469522 12:129018355-129018377 GAGCCCAGCCCTTCTGTATCAGG - Intergenic
1105354758 13:19649644-19649666 GACACCAGACTGTCTATAGCTGG - Intronic
1105687055 13:22793994-22794016 GAACCTAGTCTGTCCATATATGG + Intergenic
1106637499 13:31544653-31544675 GAATCCAGCTTCTCTACATCTGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1117622094 14:57597912-57597934 GAAACCAGGCTGTCTAAACCTGG + Intronic
1120292999 14:82601329-82601351 GAACCCAGCCTAAATAAATCAGG + Intergenic
1120644545 14:87058032-87058054 GAACACAGCCAAACTATATCAGG - Intergenic
1120861667 14:89260465-89260487 TAACCCAGCTCATCTATATCAGG + Intronic
1122604129 14:102937275-102937297 GCCCCCAGCCTGTCTTTGTCTGG - Intronic
1126917241 15:53479391-53479413 GAACCCAGGCTATCTAGCTCTGG - Intergenic
1129680368 15:77655430-77655452 GGACCCAGCGTGTCTATGTTTGG - Intronic
1133038967 16:3049842-3049864 GAACCCAGGCAGTCTGTCTCTGG - Intronic
1134823570 16:17266538-17266560 GAACCCAGGCTGTCTAGGTCTGG + Intronic
1136026112 16:27470034-27470056 GACCCCTGCCCGTCTGTATCTGG + Intronic
1140002276 16:71037853-71037875 GAATCCAGCCTGACTATGGCTGG + Intronic
1141850710 16:86643808-86643830 CAACCCAGCCTCTCTACATGTGG + Intergenic
1143065854 17:4246695-4246717 CAACCCAGCATGACTATAGCTGG + Intronic
1144482607 17:15640119-15640141 GAACCAAGACTGTCTGTCTCTGG + Intronic
1144916080 17:18724913-18724935 GAACCAAGACTGTCTGTCTCTGG - Intronic
1149129065 17:53273693-53273715 GAACCAAGCATCTCTATAACTGG + Intergenic
1152210834 17:79002252-79002274 GAGCCCAGATGGTCTATATCAGG - Intronic
1153844968 18:9041446-9041468 GCACCCAGCCCCTCTATAACTGG - Intergenic
1156106994 18:33675325-33675347 GAATACAGGCTGTCTCTATCTGG - Intronic
1159878325 18:73834237-73834259 GAACCCATGCTGTCCACATCAGG - Intergenic
1162482165 19:10934156-10934178 GCACCCAGCCTATATATGTCTGG - Intergenic
1162855049 19:13461667-13461689 GAACTCAGGCTTTCTAAATCGGG - Intronic
925716603 2:6789699-6789721 GAAGCCAGCCAGACTATGTCAGG + Intergenic
926053556 2:9760246-9760268 TAATCCAGCCTGGTTATATCAGG + Intergenic
926181928 2:10652286-10652308 GAACCCAGCCTTCCTGTTTCTGG - Intronic
934301273 2:91777731-91777753 GAACCCTGCCTGTCTCCATTAGG - Intergenic
934689753 2:96349175-96349197 TACCACAGCCTGTCAATATCAGG - Intronic
938236177 2:129708801-129708823 GAACCCAGCCAGCCTACTTCTGG - Intergenic
944973991 2:205026354-205026376 GAAAAAAGACTGTCTATATCAGG - Intronic
947401053 2:229732053-229732075 GAGCCCAGCCGTTCTGTATCAGG - Intergenic
947401068 2:229732132-229732154 GAGCCCAGCCGTTCTGTATCAGG - Intergenic
1169158882 20:3358943-3358965 ATACACGGCCTGTCTATATCAGG - Intronic
1172592112 20:36125159-36125181 GTTCCCAGCCTGTCTCTCTCTGG - Intronic
1175935299 20:62511212-62511234 GCACCCAGCCTGCCTTTGTCAGG - Intergenic
1180815167 22:18784989-18785011 GAACCCTGCCTGTCTCCATTAGG + Intergenic
1181201357 22:21219326-21219348 GAACCCTGCCTGTCTCCATTAGG + Intronic
1181700391 22:24617637-24617659 GAACCCTGCCTGTCTCCATTAGG - Intronic
1183096491 22:35555206-35555228 GCTCCCAGCCTGTGCATATCTGG + Intergenic
1183669726 22:39265310-39265332 AAACCCAGGCTGTCTGGATCAGG - Intergenic
1203225557 22_KI270731v1_random:76104-76126 GAACCCTGCCTGTCTCCATTAGG - Intergenic
1203265273 22_KI270734v1_random:10680-10702 GAACCCTGCCTGTCTCCATTAGG + Intergenic
949201617 3:1387272-1387294 CAGCCCAGCCTGTCTAAAACTGG - Intronic
954397406 3:50299997-50300019 AAACCCAGGCTGTCTAGCTCCGG - Exonic
957502180 3:81071112-81071134 GAACCTCTCCTGTCTTTATCAGG - Intergenic
960170909 3:114460087-114460109 GAACCCAGTCTGTCTGTCCCTGG + Intronic
961635508 3:128330395-128330417 AAACCCAGCCTGTCTACCTGGGG + Intronic
962359571 3:134726521-134726543 TAGCCCAGCCTTCCTATATCTGG - Intronic
965977718 3:174645036-174645058 GAACCCAGCCTCTGTGAATCTGG - Intronic
966152377 3:176878251-176878273 GAAGCCAGCCTGTCTTTCACTGG + Intergenic
966943890 3:184764171-184764193 GAACCCAGACAGTCTAGTTCCGG + Intergenic
969726215 4:8920036-8920058 GAACTCTGCCTGTCTCTTTCAGG + Intergenic
970567020 4:17341375-17341397 GAACCCAGGCTGTCTAACTCTGG - Intergenic
972344834 4:38183955-38183977 CCTCCCAGCCTGTCTACATCTGG - Intergenic
975707836 4:77128473-77128495 GAGCCCAGCCCTTCTGTATCAGG + Intergenic
976469001 4:85405194-85405216 AAACCCAGCCTGTCTATGTTTGG + Intergenic
978951219 4:114561759-114561781 GAGCCCAGCCCTTCTGTATCAGG + Intergenic
982072754 4:151709771-151709793 GAACCCAGACTATATATAGCAGG - Intronic
982264997 4:153530332-153530354 TAATGCAGCCTGTCTAGATCAGG - Intronic
984091859 4:175385335-175385357 GAACCCATCTTCTCAATATCAGG + Intergenic
985822691 5:2170658-2170680 GAGCTCAGCCTGTCTCTCTCTGG - Intergenic
990627360 5:57629364-57629386 GAACCCAAACTGCATATATCTGG - Intergenic
994153195 5:96473616-96473638 GAATGGAGCCTGACTATATCGGG + Intergenic
1000100033 5:158007467-158007489 GAGCCCAGCCCCTCTGTATCAGG - Intergenic
1006000072 6:30957610-30957632 GATCCCTCCCTGTCTCTATCCGG - Intergenic
1007228322 6:40330201-40330223 CAGCCCAGCCTGTCAAGATCTGG + Intergenic
1010709848 6:79161386-79161408 GAACACAGCCAAACTATATCAGG - Intergenic
1018859062 6:167698114-167698136 GAACCCAGGCTGTCTGTTTTTGG + Intergenic
1020968089 7:14898357-14898379 GAACCCAGGCAGTCTAGCTCTGG - Intronic
1026674803 7:72419565-72419587 GAGCCCAGCCATTCTATATCAGG - Intronic
1028401970 7:90434010-90434032 GCACCCAGGCTGTCTATGCCCGG + Intronic
1028512650 7:91642226-91642248 GAATCCAGGCAGTCTATCTCTGG - Intergenic
1031127602 7:117792114-117792136 GAAGCCTGCCTGTCAATACCTGG + Exonic
1033262170 7:139853382-139853404 GAACCCAGGCTGTCTGGCTCTGG - Intronic
1035141408 7:156766326-156766348 GAACCCACCATATTTATATCGGG - Intronic
1037442413 8:18929642-18929664 CAACTCCACCTGTCTATATCTGG + Intronic
1038813953 8:30881913-30881935 GCACCCAGCCTTTCTTTTTCTGG + Intronic
1042993753 8:74669914-74669936 GACTCCAGTGTGTCTATATCTGG + Intronic
1046604963 8:116361264-116361286 AAAGCCACCCTGTCTGTATCTGG - Intergenic
1057952696 9:99382583-99382605 GAATCCAGCTTGTCTATCCCAGG - Intergenic
1058933290 9:109743615-109743637 GACCCCAGGATGTCTATTTCAGG + Intronic
1058970517 9:110078221-110078243 GAATACACCCTGTCTAAATCAGG - Intronic
1062306290 9:135908433-135908455 GCTCCCAGCCTGTCTGTACCTGG + Intergenic
1185753888 X:2637124-2637146 CCACCCACCCTGTATATATCAGG - Intergenic
1185753894 X:2637208-2637230 CCACCCACCCTGTATATATCAGG - Intergenic
1195466649 X:105186513-105186535 GAAGTCAGCCTGTCTAGAGCAGG + Intronic
1198389612 X:136161082-136161104 GAACCCAGCCTGTCTATATCTGG - Intronic