ID: 1198390372

View in Genome Browser
Species Human (GRCh38)
Location X:136168065-136168087
Sequence AGCAGGGCCTCCCCCACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 1, 2: 5, 3: 26, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198390372_1198390379 23 Left 1198390372 X:136168065-136168087 CCTTGTGTGGGGGAGGCCCTGCT 0: 1
1: 1
2: 5
3: 26
4: 222
Right 1198390379 X:136168111-136168133 CCTTACCTCTATGAGGTAGGTGG 0: 2
1: 0
2: 2
3: 6
4: 87
1198390372_1198390376 16 Left 1198390372 X:136168065-136168087 CCTTGTGTGGGGGAGGCCCTGCT 0: 1
1: 1
2: 5
3: 26
4: 222
Right 1198390376 X:136168104-136168126 CGTACGTCCTTACCTCTATGAGG 0: 1
1: 1
2: 0
3: 4
4: 33
1198390372_1198390373 -8 Left 1198390372 X:136168065-136168087 CCTTGTGTGGGGGAGGCCCTGCT 0: 1
1: 1
2: 5
3: 26
4: 222
Right 1198390373 X:136168080-136168102 GCCCTGCTAAATGCTTTACATGG 0: 1
1: 1
2: 5
3: 22
4: 150
1198390372_1198390377 20 Left 1198390372 X:136168065-136168087 CCTTGTGTGGGGGAGGCCCTGCT 0: 1
1: 1
2: 5
3: 26
4: 222
Right 1198390377 X:136168108-136168130 CGTCCTTACCTCTATGAGGTAGG 0: 1
1: 1
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198390372 Original CRISPR AGCAGGGCCTCCCCCACACA AGG (reversed) Intronic
900188372 1:1343267-1343289 CCCAGGGCTTCCCCCACACTGGG + Intronic
900323241 1:2095249-2095271 GGCAGGCCCTCCCCTACAGAGGG - Intronic
900347147 1:2215268-2215290 AGCAGGATCTGCCCCACACTGGG - Intergenic
900644643 1:3703376-3703398 AGCAGGGCCTTCCTCAGGCAGGG - Intronic
901530953 1:9852171-9852193 AGCCGGGTCTCCCCCACAGCCGG + Intronic
901810124 1:11762605-11762627 AGAAGGGCCTGTCCCACCCAAGG - Intronic
902257129 1:15197212-15197234 ATCAGGGCCTCCCACACTCTGGG - Intronic
902370878 1:16006126-16006148 GGCAAGGCATCCCCCACCCATGG - Exonic
902579417 1:17398867-17398889 GACAGGCCCTCCCCCACCCAGGG - Intronic
904438132 1:30512609-30512631 AGCCAGGGCTCCCTCACACAGGG - Intergenic
905172007 1:36115090-36115112 AGCTGGCCCTTCCCCACCCAGGG + Intronic
905212198 1:36382006-36382028 AGCAGAGCCCCAGCCACACATGG + Intronic
907461337 1:54607486-54607508 AGCAGGGCCACCCTTACCCAGGG + Intronic
910464105 1:87478185-87478207 AGAAGGGCCCCTCCCTCACAAGG - Intergenic
910968463 1:92831093-92831115 AGCAGGGCCTGACCAAGACATGG + Intergenic
911094536 1:94044798-94044820 AGGAGGGCCACCCCCACACCAGG + Intronic
912580283 1:110714752-110714774 AGCGGGACATCCCTCACACAGGG + Intergenic
914995611 1:152541023-152541045 TGCAGAGCCTGCCACACACAGGG + Intronic
915294738 1:154912075-154912097 GGCAGGGCCTCCCCCACCTCAGG + Intergenic
918095499 1:181330563-181330585 AGCAGGCCTTGCCCCACCCAAGG - Intergenic
919586836 1:199449373-199449395 AGGAGGGGCTCACCCACGCAGGG + Intergenic
920210320 1:204323204-204323226 AGGGGGGCCTCCCCCAGGCAAGG - Intronic
920315181 1:205071763-205071785 AGCAGGGACTCACACCCACATGG + Intronic
920409715 1:205749797-205749819 AGCAGGGCCCCCCACGCTCAAGG + Intronic
923773044 1:236954176-236954198 CCCAGGGCCTCGCCCACCCAGGG - Intergenic
1062840144 10:663895-663917 AGGACGGCCTCCTCCCCACAAGG + Intronic
1063432045 10:5999513-5999535 AGCCGGGCCCCCTCCCCACAGGG - Intergenic
1067538475 10:47134773-47134795 GGCAGGGCCTGCCTCACACATGG + Intergenic
1067538693 10:47136065-47136087 AGCAGGGACTCTCCCTCACAGGG - Intergenic
1070966238 10:80532971-80532993 AGCAGGGACCCCCCCAGAGAGGG - Exonic
1073011050 10:100360008-100360030 ATCAGCACCTCCCCCACACCAGG + Intronic
1076106565 10:127827979-127828001 AGCAGGGGAGCCCCCACACTGGG - Intergenic
1076357784 10:129865537-129865559 GGCAGTGCCTGCCCCACACTAGG - Intronic
1076599273 10:131646592-131646614 CCCAGGGCCTCCTCCACACCAGG - Intergenic
1076704008 10:132291375-132291397 AGCAGAGCCTCATCCTCACAAGG - Intronic
1076714057 10:132354437-132354459 AGCGGGGCCAGCACCACACATGG + Intronic
1076992748 11:284307-284329 AGCTGGGCCTCCTCCACAACAGG + Exonic
1077164817 11:1130250-1130272 AGCAGGGCTTCCCCCTGCCAAGG - Intergenic
1077192953 11:1263125-1263147 AGCGGGGCCTTCCCCACACCGGG + Intergenic
1077888644 11:6403672-6403694 GGCCGGGCCTCCCCCTCACAGGG - Exonic
1079404500 11:20132538-20132560 AGCACGGCCTGTCCCAAACAGGG - Intergenic
1079971429 11:27040525-27040547 AACAGGGTCTCCCCCACACTGGG + Intergenic
1083384451 11:62297160-62297182 AGCTGGGCCTCCCACAGACAGGG - Intronic
1083642320 11:64152264-64152286 ACCAGGGCCTCCCCCGAGCAGGG + Intronic
1084715092 11:70868671-70868693 CCCAGGGCCCCACCCACACAGGG + Intronic
1089254909 11:117189072-117189094 AGAGGGGCCTCCCTCACACAGGG - Intronic
1089446199 11:118554397-118554419 AGCAAGGCCTCCTCCACTCTTGG + Intronic
1090255557 11:125281257-125281279 AGCTGGGCCTTCTCTACACACGG - Intronic
1092155219 12:6278176-6278198 TGCTGGGCCTCCCACTCACAAGG - Intergenic
1092523223 12:9294094-9294116 AGCAGGGCCTTCTCCACACAAGG + Intergenic
1092544069 12:9437805-9437827 AGCAGGGCCTTCTCCACACAAGG - Intergenic
1095698439 12:45165897-45165919 AGGGGAGCCTCCCCCACTCAGGG - Intergenic
1096484607 12:51970193-51970215 AGCAGGGCCACGGCCACACTAGG - Intronic
1096876573 12:54634474-54634496 AGCAGGGTGTCCCCTACACGAGG - Intronic
1097319429 12:58208797-58208819 CGCAGTGCCTGCCCCACACCTGG - Intergenic
1100294197 12:93245646-93245668 TGCAGGGCCTCGCCAGCACAGGG - Intergenic
1102033977 12:109760534-109760556 AGCAGGGCCAACCACACACCAGG - Intronic
1103272967 12:119688691-119688713 ACCAGGGGCTCCCCCAGGCAGGG - Intronic
1103321083 12:120093281-120093303 AGCAGGCCCTCCCGGACCCATGG - Exonic
1103794577 12:123494552-123494574 GGCAGGGCCTGGCCCACACCGGG - Intronic
1104641283 12:130468934-130468956 AGCAGGGCCTCCCCCTCATCCGG - Intronic
1105293571 13:19070284-19070306 AGCAGGGCCTTGCACGCACATGG + Intergenic
1105511772 13:21057898-21057920 AGCAGGGCTGCCCTCACACTGGG + Intronic
1107447593 13:40482398-40482420 AGCAGGTCCACCCTCAGACAAGG + Intergenic
1108334134 13:49421613-49421635 ACCAAGGCCTCCCCTCCACATGG + Intronic
1112608046 13:100927352-100927374 AAGAGGGCCTTCCCCAGACAGGG + Intergenic
1113465886 13:110512637-110512659 AGCAGGGCCAGGCCCACCCACGG - Exonic
1113592903 13:111513189-111513211 AGAAAGGCCTTCCCCACACTTGG - Intergenic
1113778970 13:112965207-112965229 AGCAGGTCCTGGTCCACACACGG - Intronic
1113881793 13:113631014-113631036 TGCAGGGGTTCCCCCAGACAGGG + Intronic
1113906869 13:113823353-113823375 GGTAGGGCCTCCGCCACCCAGGG - Exonic
1113948775 13:114059714-114059736 GGCAGGGCCTCCCACACACCAGG + Intronic
1116886878 14:50231113-50231135 AGCAGGTCGTCCCTCCCACAGGG - Intronic
1118035112 14:61858240-61858262 ATCAGGGCCTTCCGCATACAGGG + Intergenic
1122155260 14:99746827-99746849 AGCAGGGCTCCTCCCACCCAGGG + Intronic
1122180522 14:99951039-99951061 CTCAGTGCCTCCCCAACACAGGG - Intergenic
1122308906 14:100782550-100782572 ACCAGGGCCTCACCCCCACCAGG - Intergenic
1122465098 14:101928050-101928072 GTCAGGGCCGCCCACACACAGGG + Intergenic
1123781692 15:23634522-23634544 AGCACGGCCTCCCGCTCACTGGG + Intergenic
1125323687 15:38514910-38514932 GGCAGTGCCTCCCCGTCACAGGG - Intronic
1125835579 15:42747665-42747687 AGCAGGCCCTCCCCACCCCAGGG - Intronic
1126552343 15:49946779-49946801 AGCAGGGGCTGCCCCAGACTGGG + Intronic
1128315938 15:66659442-66659464 AGCATGGCCTCTCCCTGACAGGG + Intronic
1128508252 15:68295039-68295061 AGCATGCCCTCCCCCAAATAAGG + Exonic
1128979564 15:72176332-72176354 GGCAGGGCCTTCCCCACAGCTGG + Intronic
1129937549 15:79463338-79463360 AGCTGGGCTTCCCCCACCCAGGG - Intronic
1132385898 15:101399624-101399646 AACAGTGCCTCCCCCAGAGAAGG + Intronic
1132731203 16:1362877-1362899 AGCACGGCATCCCCTACACGAGG + Exonic
1132800490 16:1749847-1749869 AGCAGGGCCTCACCCTGACAGGG + Intronic
1137387701 16:48056607-48056629 AGCAGAGCCTCCTCCAGTCATGG + Intergenic
1137598022 16:49737767-49737789 ACCAGGGCCTCACCCTCCCAAGG + Intronic
1138477989 16:57283533-57283555 ATCAGGCCCTCACCCACCCAGGG + Intronic
1139365154 16:66428168-66428190 GGCAGGGCCCACCCCACACCCGG + Intronic
1139379305 16:66520476-66520498 TGCAGGGCCTCCCCCAGCCAGGG + Intronic
1139395475 16:66635417-66635439 AGGAGGACCTTCCCCACCCAGGG + Intronic
1139563701 16:67759586-67759608 AGCATGGCTTCCCTCACAGAGGG + Intronic
1140336074 16:74106331-74106353 AGCAGTGCCTTCCCCGCAGAGGG + Intergenic
1140482017 16:75266951-75266973 AGAAGGGCCCGCCCCCCACATGG - Intronic
1140901229 16:79369923-79369945 AGGATGGCTTCCCCCACAGAGGG + Intergenic
1141000048 16:80299506-80299528 AGCAGGGCCACCCCAAGACAGGG + Intergenic
1141554500 16:84827958-84827980 AGCAGGACATCCCGGACACACGG - Intronic
1141680821 16:85542734-85542756 AGCAGGGCCACCCACAAACCAGG - Intergenic
1142803657 17:2360447-2360469 AGCAGGACCTCTCCCCGACAGGG - Intronic
1143255940 17:5558128-5558150 AGCAGGGCCTGCCCCACAGCCGG + Intronic
1146323794 17:31868188-31868210 ACCAGTGCCTCCACAACACATGG + Intronic
1146653860 17:34623627-34623649 ATCAGTCCCTCCCCCTCACAGGG - Intronic
1147888589 17:43701278-43701300 AGCACCCCCTCCCCCACCCAAGG + Intergenic
1147958495 17:44151432-44151454 AGCAGGGTCTCACCCACCAAAGG - Intronic
1150604122 17:66676435-66676457 AGAGGGGCCTCTCCCACACCAGG + Intronic
1152797542 17:82315580-82315602 AGCAGAGCCTTCCCCAGGCAGGG + Intronic
1152889373 17:82871747-82871769 AGCAGGGCCTCCCCGGCATGTGG + Intronic
1153009527 18:525416-525438 AGAAGGGCCTCAGCCACAGAAGG - Intergenic
1155440119 18:25853514-25853536 GGCAAGGTCTCCCCTACACAGGG + Intergenic
1156471230 18:37378320-37378342 GGCTGGGCCACCCCCACAGAAGG + Intronic
1158848547 18:61470434-61470456 GGCAGGGCCTCCCTCACAGTAGG - Intronic
1160073026 18:75645053-75645075 GGCAGGGCCACCCTCACCCAAGG - Intergenic
1161044840 19:2129242-2129264 CGCAGGGAATGCCCCACACAGGG + Intronic
1161444610 19:4311159-4311181 AGAAGGGCCTGCCCACCACATGG + Intronic
1161771479 19:6233401-6233423 ATCAGGGCTTTCCCCACACAAGG - Intronic
1161837893 19:6660132-6660154 AGCAGGGGCTCCCCAACCCACGG - Intergenic
1163149581 19:15403036-15403058 AGCTGGGCCACCCCCACGTAAGG - Intronic
1163535191 19:17872728-17872750 CCCAGCGCCTCCCCCACACGGGG - Intronic
1164281274 19:23770800-23770822 AGAAGTGCCACACCCACACATGG - Intronic
1166001746 19:39881593-39881615 AGGCTGGCCTCTCCCACACAGGG - Intronic
1166004528 19:39897844-39897866 AGGCTGGCCTCTCCCACACAGGG - Intronic
1166319062 19:42005406-42005428 ACCAGGTCCTCACCCCCACAGGG + Intronic
1166948589 19:46412134-46412156 AGCCGGGCCTCGCCCACCCCGGG + Exonic
1166980973 19:46631832-46631854 TGCTGGGCCTCCCCTCCACAGGG - Intergenic
1167095925 19:47375163-47375185 AGCAGGGCCCCCCAGACCCAAGG + Intronic
1167209871 19:48127462-48127484 AGCATGGCCGCCCTCACAGATGG - Intronic
1167488261 19:49776100-49776122 AGCACGGCCTGCCCCTCCCATGG + Intronic
929451783 2:42042781-42042803 AGGAGGGCCTCCCCCTCTGACGG + Intergenic
929966467 2:46541146-46541168 AGCAGGGCCTGCCCCATTCTTGG - Intronic
935702205 2:105822356-105822378 AGCTGGGGATCCCCAACACAAGG - Intronic
937198364 2:120180268-120180290 AGCAGCCCCTCCCCCACAGCAGG + Intergenic
938140544 2:128791328-128791350 GACAGGGCTCCCCCCACACATGG + Intergenic
938766168 2:134461816-134461838 AGCCGGCCCTCTCCCACAAAGGG + Intronic
940704424 2:157086079-157086101 ACAAAAGCCTCCCCCACACAAGG + Intergenic
943089632 2:183358367-183358389 AGCAGGGCCGCCCTCCCACCTGG + Intergenic
943276505 2:185875403-185875425 AGGAGAGGCTCCCCAACACAGGG + Intergenic
948591613 2:239054116-239054138 AGCCAGGACTCCCTCACACAGGG + Intronic
948593598 2:239066050-239066072 AGCAGGGCCTCCACCAGGCGTGG - Intronic
948648747 2:239425806-239425828 AGCAGGGGCTTCCCAACACTTGG - Intergenic
948756794 2:240164805-240164827 TGCAGGGCCTCCCCAGCACAGGG + Intergenic
948909157 2:240994379-240994401 AGGAGACCCTCCCCCACACAAGG + Intergenic
948975994 2:241464239-241464261 AGCAGGGTCTCCTCAAAACAAGG + Intronic
949031506 2:241799410-241799432 AGCCCTGCCTCCCACACACAGGG - Intronic
1170831700 20:19848242-19848264 AGCAGGGTCTCGGCCAGACAAGG + Intergenic
1171188626 20:23142152-23142174 ACCAAGTCCTCCCCCGCACAGGG + Intergenic
1171227243 20:23451930-23451952 AGCTGTGCCTCCCCCACGCCTGG - Intronic
1171867841 20:30501230-30501252 GGCAGGGCCTCCCCGTCACGAGG + Intergenic
1171878168 20:30597681-30597703 AGCAGGGCCTCACACACACATGG + Intergenic
1172414032 20:34749803-34749825 ACCAGGGCCCAGCCCACACATGG - Exonic
1176046926 20:63097540-63097562 GACAGGCCCTCCCCCACACGTGG + Intergenic
1179731083 21:43367796-43367818 ATCAGGGCCTCCTCCTCTCAAGG + Intergenic
1180699119 22:17772309-17772331 CACAGGGCCTCCCACTCACAGGG - Intronic
1180836038 22:18929866-18929888 AGCCGGGCCTGACCCACATAAGG - Intronic
1181028103 22:20137234-20137256 AGCCTGGACTCCCCCACACCAGG - Intronic
1181167058 22:20989518-20989540 AGGAGCCCCACCCCCACACAGGG - Intronic
1181630591 22:24149147-24149169 ACCAAGGACTCCCTCACACATGG + Intronic
1181877694 22:25952863-25952885 AACAGGGCCTAGCCCACACTGGG - Intronic
1182380627 22:29883873-29883895 AGCAGGGCATCCCCCTGACCTGG + Intronic
1182520736 22:30883267-30883289 CCCAGGGCCACCTCCACACAAGG - Intronic
1183327485 22:37202359-37202381 AGCAGGGCCTGCCAGAGACAGGG + Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184988539 22:48152698-48152720 AGCAGGGCCTCCCAGCCACCTGG + Intergenic
1185383644 22:50521761-50521783 CCCAGAGCCTCCTCCACACAGGG - Exonic
1203286130 22_KI270734v1_random:155165-155187 AGCCGGGCCTGACCCACATAAGG - Intergenic
950484681 3:13266104-13266126 AACAGTGCCTCCCTCAGACAAGG - Intergenic
953137711 3:40197374-40197396 AGCAGGGGGTCCCCAACTCAGGG - Intronic
953668078 3:44940281-44940303 AGCAGGGCAGCCCAAACACAAGG + Intronic
954234477 3:49245849-49245871 ACCTGGGCATCCCACACACAGGG + Intronic
955037633 3:55284326-55284348 AGCAGAGCCTCACCCATTCACGG + Intergenic
955746971 3:62149665-62149687 AGGAGGGCCTGCCAAACACAGGG - Intronic
956622887 3:71238794-71238816 ACAAGTGGCTCCCCCACACAAGG + Intronic
958807919 3:98834046-98834068 AGAGGAGCCTCCCCCACCCAGGG - Intronic
959957018 3:112251278-112251300 AGGGGAGCCTCCCCTACACAGGG + Intronic
962629934 3:137265438-137265460 ACCAGGGGCTGCCCCAAACATGG + Intergenic
962944300 3:140153449-140153471 AGCAGGGCCTGCCCCAGAACTGG - Intronic
968549492 4:1214804-1214826 AGCCCAGCCTCCCCCACGCAGGG + Intronic
969274659 4:6127323-6127345 AGCATGGCACACCCCACACACGG + Intronic
969601278 4:8177901-8177923 AGCTGGGATTCCCCCACTCAGGG + Intergenic
970365537 4:15354418-15354440 TCCAGTACCTCCCCCACACATGG - Intronic
971117192 4:23662384-23662406 AGCAGAGCCTCCCTCACTAATGG + Intergenic
982574810 4:157096199-157096221 AGCCAGGCCTTCCCCAGACAGGG - Intronic
985708798 5:1416509-1416531 AGCATGGACTCATCCACACACGG + Intronic
985708819 5:1416674-1416696 AGCACGGACTCATCCACACACGG + Intronic
985966011 5:3339199-3339221 ACCAGGGGATTCCCCACACACGG + Intergenic
986885906 5:12235605-12235627 ACCAGGACCCCCTCCACACATGG - Intergenic
987293731 5:16531939-16531961 AGCATGGCCTTACCCATACAGGG + Intronic
990181840 5:53169568-53169590 AGCAGTGCTTCTCCCACACTGGG + Intergenic
990861295 5:60330595-60330617 AGCAGGGCCGCACCAACAGAGGG + Intronic
998007122 5:138664506-138664528 AGCCACCCCTCCCCCACACAAGG + Intronic
998441868 5:142169427-142169449 AGCAGCCCCTCCTCCCCACAGGG + Intergenic
1002093297 5:176817184-176817206 AGCCGGGCCTCTCCCACACTGGG + Intronic
1002105165 5:176876446-176876468 AGCAGGGACTCCCCCAGACAGGG - Intronic
1004025105 6:11810628-11810650 GGCAGGGGCTCCCCTCCACAAGG - Intergenic
1008581631 6:52913517-52913539 AGCAGGCCATGCCCCACACCAGG + Intergenic
1010183264 6:73112749-73112771 TGCAGTGCCTCCCACAGACATGG + Intronic
1013593843 6:111644128-111644150 TCCACTGCCTCCCCCACACAGGG - Intergenic
1014756658 6:125309195-125309217 AGCATGGCCTCCTCTAGACATGG + Intergenic
1015603457 6:134932969-134932991 ACCAGGGCCTCACCCACCCTGGG + Exonic
1018828449 6:167424181-167424203 AGCAGGGCTTCAACCACTCACGG - Intergenic
1018834063 6:167470325-167470347 AGCAGGGCATCCACGGCACAGGG - Intergenic
1019120573 6:169800860-169800882 TGCAGGGCCTGGCACACACAGGG - Intergenic
1019281199 7:201117-201139 AGTAGGGCCTCACCCAAAGAGGG - Intronic
1019442543 7:1054744-1054766 AGCTGAGCCGGCCCCACACACGG - Intronic
1019492545 7:1322039-1322061 AGTGGGGCCTCACCCCCACAGGG - Intergenic
1019560170 7:1651872-1651894 GGCAGGGCCTCCCCCACCCAAGG - Intergenic
1020142742 7:5621538-5621560 AGCAGGGCCTGGCCCACCCAAGG - Intronic
1024084276 7:45880827-45880849 AGCAGGACCTCTCCCACCCCAGG - Intergenic
1024638139 7:51307432-51307454 AGCCAGACCTCCCACACACAAGG + Intronic
1028789183 7:94834284-94834306 AGCAGGGCCTCCCCAATGCCAGG + Intergenic
1029283941 7:99453450-99453472 AGCAGGGCCTCCTCCCCACCAGG - Intronic
1030128793 7:106179441-106179463 AGCAGTGCCTACCTCACACAAGG - Intergenic
1032129839 7:129218932-129218954 AGCAGGGAGTCCCCCAAACTGGG - Intergenic
1032706737 7:134426544-134426566 AGCACAGCCTCCCCTCCACAGGG - Intergenic
1033259557 7:139831121-139831143 ACCAGGGCCTCCTCCAGACTGGG - Intronic
1034273650 7:149814868-149814890 GGCAGGGCCTCCCTCCCTCAGGG - Intergenic
1034670376 7:152853245-152853267 AGCAGCACCTCCCTCTCACAAGG - Intronic
1035162660 7:156962458-156962480 AACATGGGCTTCCCCACACACGG - Intronic
1035726662 8:1829064-1829086 GGCAGGGCCTCCAGCACACCTGG + Intronic
1035765546 8:2102019-2102041 AGCAGGCCCACCCCACCACAGGG - Intronic
1035991703 8:4498052-4498074 AGCAGGGTATCTCACACACATGG - Intronic
1037765065 8:21767646-21767668 GGCAGAGCCTGCCTCACACACGG + Intronic
1037818548 8:22124714-22124736 AGCAGGGCATTCCAGACACAGGG + Intronic
1037887843 8:22604495-22604517 AGCTGGGCCCCCCAAACACAAGG - Intergenic
1038192844 8:25339629-25339651 AGCAGGACCTGCCCCAGGCAGGG + Intronic
1040107566 8:43549215-43549237 AGCAGGCCCTGCCCCAGACTTGG - Intergenic
1040629462 8:49193174-49193196 AGGAGCTGCTCCCCCACACACGG + Intergenic
1042721859 8:71834666-71834688 AACTGGGCCACCCCTACACAGGG + Intronic
1047553069 8:125897731-125897753 AGCTGGGGCTCCACCACACTAGG - Intergenic
1049410185 8:142470539-142470561 AGCAGGGACACACACACACAGGG - Intronic
1049573146 8:143378845-143378867 AGCTGGGCCTCCCCTCCCCAGGG - Intronic
1049839827 8:144763782-144763804 ACCTGGGCCTAGCCCACACAGGG - Intergenic
1050121066 9:2307726-2307748 CACATGGCCTCCCCAACACAAGG - Intergenic
1050450353 9:5774103-5774125 AGCAGGGGCTCCTCCAGCCATGG + Exonic
1050643676 9:7695436-7695458 AGAAGGGCCTCACCCTCACACGG + Intergenic
1054810688 9:69431479-69431501 GGCAGTGCCTCTCCCACAGAGGG + Intronic
1057026317 9:91736488-91736510 AGCAGAGCCTCCCGCTCCCATGG + Intronic
1057174836 9:92988492-92988514 AGCAGGGGCCCCGCCACACCAGG - Intronic
1060896440 9:127221135-127221157 AGCAGGGGCTCGGCCAAACATGG + Exonic
1060924792 9:127448798-127448820 ATTGGGGCCTGCCCCACACAGGG + Intronic
1061007390 9:127935852-127935874 AGCAGAGCCACCCACACACAGGG + Intronic
1061192647 9:129090718-129090740 AGGAGGGCCAGCGCCACACAGGG - Intergenic
1061928983 9:133822563-133822585 AGCAAGGCCTCCCTCCCTCATGG - Intronic
1062197385 9:135281777-135281799 GGCAGGGCCTCCCCACCACATGG + Intergenic
1186639032 X:11435157-11435179 AGGACAGCCTCCCACACACAAGG + Intronic
1187289744 X:17941687-17941709 AGCTGATCCTGCCCCACACATGG - Intergenic
1190119074 X:47645625-47645647 TGAAGGCCCTCCCCCACAGAGGG - Intronic
1195093250 X:101483845-101483867 GAAAGGGCCTCCTCCACACAGGG + Intronic
1195114564 X:101683837-101683859 AGCAGGAGCTCCTCCACCCAAGG + Intergenic
1198390224 X:136166875-136166897 AGCAGTGCCTCCCCCACACAAGG - Intronic
1198390372 X:136168065-136168087 AGCAGGGCCTCCCCCACACAAGG - Intronic
1200055223 X:153456703-153456725 AGCAGGCCCTCAGCCCCACAGGG + Intronic