ID: 1198392049

View in Genome Browser
Species Human (GRCh38)
Location X:136186116-136186138
Sequence CCATTGCCACTAATCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198392047_1198392049 4 Left 1198392047 X:136186089-136186111 CCTCTTTAATTTTGAGAAGTATA 0: 1
1: 0
2: 1
3: 36
4: 410
Right 1198392049 X:136186116-136186138 CCATTGCCACTAATCCATCATGG 0: 1
1: 0
2: 0
3: 9
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198392049 Original CRISPR CCATTGCCACTAATCCATCA TGG Intronic
906531391 1:46525954-46525976 CCATTCCCACTAACCTCTCATGG + Intergenic
907680109 1:56555195-56555217 CCATTTCCACTCCTCCATCATGG + Intronic
909929313 1:81477090-81477112 CCATTGCCACTAACCCACCCTGG + Intronic
910780136 1:90922879-90922901 CTGTTGTCACTAATCCTTCAAGG + Intronic
915915549 1:159938318-159938340 CCAAAGCCCCTAATCCCTCAGGG + Intronic
916877087 1:168980913-168980935 CCATTGCCACCACTTCTTCAGGG - Intergenic
917720867 1:177785299-177785321 CCATTGCCTCCATTGCATCAAGG + Intergenic
918406145 1:184213539-184213561 CCAGAGTCATTAATCCATCATGG + Intergenic
918822760 1:189278007-189278029 CCATTGCCACTATTTCCTTATGG + Intergenic
919470171 1:197968687-197968709 CCCTTGGCACTAATTCATCCTGG - Intergenic
922749779 1:228064958-228064980 CCCTTGCCCCTGCTCCATCATGG + Intergenic
1067265085 10:44734972-44734994 CTATCGCCATTAACCCATCAAGG + Intergenic
1070500949 10:77071989-77072011 CCATTTCCTCAAAACCATCAAGG + Intronic
1079596013 11:22247550-22247572 CCATATCCAATAATCCATTAGGG - Intronic
1079915467 11:26364373-26364395 TCATTTCCATTAATCCAGCAAGG + Intronic
1086782320 11:90922585-90922607 CCCTTCCCACTATGCCATCAAGG + Intergenic
1091664126 12:2406911-2406933 CCTTTGCCACTGACCCAGCAGGG + Intronic
1093782659 12:23154975-23154997 CCATTGCCACAAATCCCAGAGGG - Intergenic
1097155291 12:57007484-57007506 TCCTTTCCACTTATCCATCAAGG - Intergenic
1098775241 12:74604990-74605012 CCATTGCCACAAATTCAAGAAGG + Intergenic
1099392033 12:82093506-82093528 CCATAGTCACTAAAACATCATGG - Intergenic
1109383564 13:61597949-61597971 CCATAGCAACTAATTCATCTTGG - Intergenic
1110676146 13:78247644-78247666 ACATTGACACTAATGAATCATGG - Intergenic
1118935382 14:70283311-70283333 CCATTGCCACTCAGGCATCACGG - Intergenic
1119658824 14:76436305-76436327 CAAATGCCTCTTATCCATCAAGG + Intronic
1122351745 14:101099244-101099266 TCATTGTCACTAAATCATCAAGG - Intergenic
1123993822 15:25704286-25704308 AAATTGTCAGTAATCCATCAAGG - Intronic
1125956898 15:43796730-43796752 CCCTTCCCAGTAATCCTTCAAGG - Exonic
1127570515 15:60236808-60236830 CCATTACCTGTAAGCCATCAGGG + Intergenic
1131437491 15:92434978-92435000 CCATTGCCACTACCCGATGATGG - Intronic
1132422548 15:101684812-101684834 CCATTGCCTCTAAGCCACCGTGG + Intronic
1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG + Intergenic
1140641009 16:76972930-76972952 AAATTGCTACTATTCCATCAGGG + Intergenic
1140773805 16:78230933-78230955 CCATTGCCTCAAAGCAATCATGG - Intronic
1140922659 16:79553264-79553286 CCATTGCCACCTCTCCATCATGG + Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1151713861 17:75821644-75821666 CCTTTCCCACTAATCCAACCAGG - Intronic
1158319192 18:56244699-56244721 CCTTTGCCTCTATTCCACCATGG + Intergenic
1158841044 18:61387854-61387876 CCATTGCCCCTATACAATCAGGG - Intronic
1160060166 18:75522383-75522405 ACATTGCAACTAATACATCAAGG - Intergenic
1165708135 19:37990837-37990859 CCAATGCCACTAAGTCATCATGG - Intronic
1166894379 19:46014983-46015005 CCATTCCCACTACTCCATGGGGG - Intronic
1167320268 19:48793342-48793364 CCATTGTCAATGATCCCTCAAGG - Intergenic
926153753 2:10439193-10439215 CCACTGCCACTAAGCGATCTCGG + Intergenic
928445350 2:31329178-31329200 CCATTGTCACCAATCCACAAAGG + Intergenic
931012348 2:57931028-57931050 TCATGTCCACTCATCCATCAAGG + Intronic
931844445 2:66188551-66188573 CCATTGCTAATAATCCAACCAGG + Intergenic
932162752 2:69477282-69477304 TCATTGTCACTAATCCACAAAGG + Intronic
932907330 2:75768037-75768059 CAAATTCCACTAATCCTTCAAGG + Intergenic
936140324 2:109934349-109934371 CCATATCCACTAACTCATCAGGG + Intergenic
936177014 2:110232294-110232316 CCATATCCACTAACTCATCAGGG + Intergenic
936204371 2:110437137-110437159 CCATATCCACTAACTCATCAGGG - Intronic
937400996 2:121583530-121583552 CCACTGCCACTTATCCATTTTGG + Intronic
939774643 2:146369099-146369121 CCGTTGCCACAAGTCCACCAAGG - Intergenic
941334128 2:164220181-164220203 CCACTCCCCCTACTCCATCATGG + Intergenic
943424505 2:187714110-187714132 CAATTCCAACTAATCCTTCAGGG + Intergenic
945715431 2:213352542-213352564 CTCTTTCCACTAAACCATCAAGG - Intronic
1169691980 20:8342446-8342468 CCCTTGCCAATAATCCATGAAGG - Intronic
1169992216 20:11515964-11515986 CCATTGCCAAGAACCCAGCAAGG - Intergenic
1170404336 20:16020327-16020349 CCATTCCCATTCATCCTTCAGGG + Intronic
1172891343 20:38267963-38267985 CAGATGTCACTAATCCATCATGG + Intronic
1175948987 20:62572399-62572421 CTCAAGCCACTAATCCATCAAGG + Intergenic
1177802347 21:25840309-25840331 CCCTTCCCACTCTTCCATCAAGG + Intergenic
1178770889 21:35502957-35502979 GCAGTGACACTATTCCATCACGG - Intronic
1182074079 22:27483120-27483142 GCATTGCCATTCATCCCTCATGG - Intergenic
949239147 3:1849272-1849294 GCAGTGCCACTAATCTGTCAGGG - Intergenic
950572309 3:13809057-13809079 CCAGGGCCACACATCCATCAGGG - Intergenic
950928914 3:16770017-16770039 CCTTTGCTGCTAATCCATCTCGG + Intergenic
952979560 3:38723734-38723756 CCATTGCCAGCACTCCATCAGGG - Intronic
957273306 3:78058915-78058937 CCCTTGCCACTTATGCCTCATGG + Intergenic
960538038 3:118834602-118834624 CCATTACCACTGCTCCACCAAGG + Intergenic
980617448 4:135249183-135249205 TTATTGCCACTTATCCAGCAGGG + Intergenic
982158354 4:152542136-152542158 CTATTGCCAGCAATCCCTCATGG + Intergenic
989453930 5:41620282-41620304 CTGTTTCCAATAATCCATCATGG + Intergenic
994239485 5:97405161-97405183 CCTTGGGCACTAATCAATCATGG - Intergenic
1000388731 5:160701038-160701060 CCATTGCCACACACCCATCCAGG + Intronic
1005702941 6:28421472-28421494 CTATAGCCAGTAATCCATTACGG - Intergenic
1009621611 6:66085002-66085024 CCATTGCAACCAATGCTTCATGG - Intergenic
1012040193 6:94194431-94194453 CCACTGCCACTGAACCAGCAAGG - Intergenic
1029306010 7:99620525-99620547 CCTTTCCCAGTCATCCATCAGGG - Intronic
1042106310 8:65330723-65330745 CCATTGCCACTAAAACTTGACGG + Intergenic
1190131731 X:47754252-47754274 CCATTGACACTACCCCAGCAGGG + Intergenic
1198392049 X:136186116-136186138 CCATTGCCACTAATCCATCATGG + Intronic
1198894652 X:141439554-141439576 CCATAGCCACTAAAACAGCATGG - Intergenic
1201978430 Y:19880170-19880192 CCAGTGACACTGATCCACCAAGG + Intergenic