ID: 1198394583

View in Genome Browser
Species Human (GRCh38)
Location X:136208804-136208826
Sequence TTGCAAAGGCTAACCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198394583 Original CRISPR TTGCAAAGGCTAACCTGGCC TGG (reversed) Intronic
900242026 1:1621715-1621737 TTGGAGAGGCCAAGCTGGCCAGG + Intronic
900884235 1:5404030-5404052 GTGCAAAGGCCAATCTGCCCAGG + Intergenic
901415191 1:9111535-9111557 TTGCGAAGGCTGACATTGCCGGG - Intronic
902175469 1:14646917-14646939 TTGCACAGGCTCACATGCCCTGG - Intronic
906969881 1:50501367-50501389 TTTAAAAGACTAACCAGGCCAGG + Intronic
908202294 1:61810143-61810165 TTGAAAATTCAAACCTGGCCAGG - Intronic
909356001 1:74711061-74711083 TGGCCATGGCTAACCTGGCGAGG + Intronic
911137918 1:94462445-94462467 CTGCAAAGGATCACCTGGACTGG - Intronic
914869727 1:151462830-151462852 TTGTAAAAGGTATCCTGGCCAGG + Intergenic
915291540 1:154887543-154887565 TTGAAAATGCAAATCTGGCCAGG + Intergenic
916549930 1:165840212-165840234 TTTTAAAGGCTGACCAGGCCGGG - Intronic
917543737 1:175940433-175940455 TTACAAAGACTACCTTGGCCAGG - Intergenic
921979768 1:221243244-221243266 ATGCAAAGGTTAACCTGACAAGG - Intergenic
1063342251 10:5277199-5277221 TAGCACAGGGCAACCTGGCCTGG + Intergenic
1063697224 10:8348538-8348560 TTGTGAAGACAAACCTGGCCAGG + Intergenic
1064056103 10:12098873-12098895 TTTCAAACACTAACTTGGCCAGG + Intronic
1064783913 10:18873418-18873440 TTGCCATGGCTAACTGGGCCTGG - Intergenic
1075251263 10:120876273-120876295 CTTAAAAGGTTAACCTGGCCTGG - Intronic
1079967684 11:26998666-26998688 TTGCAGAGGCTAAAGTAGCCTGG - Intergenic
1080085734 11:28279603-28279625 TAGGAAAGACTAACATGGCCGGG + Intronic
1080407989 11:31996986-31997008 GTGGAAAGGCTAAACTGGCTAGG - Intronic
1084071616 11:66740183-66740205 GTGCAAAGGGTGACTTGGCCAGG + Intergenic
1084376342 11:68780577-68780599 TTGAAAATCCAAACCTGGCCAGG - Intronic
1085984313 11:81766742-81766764 TATCAGAGGCTAACCAGGCCTGG - Intergenic
1089067616 11:115674028-115674050 TTGCCGATGCTAACCTTGCCAGG + Intergenic
1089472591 11:118732882-118732904 TTGAAAACCCTTACCTGGCCAGG + Intergenic
1091204023 11:133806838-133806860 ATGAAAAGGCTAAACCGGCCAGG + Intergenic
1091398380 12:168363-168385 TTGCGGAGGCTCAGCTGGCCAGG + Intronic
1097224584 12:57469870-57469892 ATGCAAAGGCTAGCCAGGCATGG + Intronic
1097819567 12:64114644-64114666 TTAAAAATGCTAACCAGGCCAGG - Intronic
1099308967 12:80994258-80994280 TTTTCAAGGCTAACCTGGCCAGG + Intronic
1100385733 12:94103060-94103082 TTTCAAAGGTTCACCTGGCTAGG - Intergenic
1101010757 12:100446790-100446812 TTGAAGAGGCTACCATGGCCGGG + Intergenic
1102483145 12:113237719-113237741 TTTCATAGGCTCACCTGGCCTGG + Intronic
1102861445 12:116339712-116339734 TTGAAAAGGGTATCCTGGCCGGG - Intergenic
1103492146 12:121329908-121329930 TTGAAAAGGCTTATCTGGCTGGG - Intronic
1103768823 12:123303792-123303814 TTGCAGAGGCTGAGCTGGTCTGG - Intronic
1104292136 12:127479963-127479985 GTGAAAAGGCTAGACTGGCCTGG + Intergenic
1107549485 13:41461735-41461757 TTGCTTAGGCTATTCTGGCCTGG + Intronic
1108465536 13:50711657-50711679 TTGCAAAGTCTAATCTGGAAGGG + Intronic
1110827320 13:79987740-79987762 TTGCACAGGCTAACCAGCGCTGG - Intergenic
1118769144 14:68929906-68929928 TTGCAAAGAGGGACCTGGCCAGG + Intronic
1120144829 14:80968268-80968290 GTGCAAAGGCTAACCAACCCTGG - Intronic
1122370308 14:101225775-101225797 TTGCCAAGGCCTACCAGGCCAGG - Intergenic
1123900266 15:24869714-24869736 TGACAAAGGCTAACTTGTCCAGG - Intronic
1124658777 15:31528478-31528500 TTTCAAAGGCTCAACTGGCTGGG + Intronic
1125700470 15:41678468-41678490 TTGAAAAGACTGTCCTGGCCGGG + Intronic
1131646214 15:94348217-94348239 TTGCAAAGGCTGACCTCTGCAGG + Intronic
1134659629 16:15974259-15974281 TGGCAAAAACAAACCTGGCCTGG + Intronic
1137596519 16:49727618-49727640 TTGCAAGGGCTGACCCTGCCAGG + Intronic
1137754593 16:50891435-50891457 TTCTCAAGGCTCACCTGGCCTGG - Intergenic
1139685258 16:68598431-68598453 TAGAAAAGGCTTACCAGGCCGGG + Intergenic
1143219428 17:5249053-5249075 ATGCAAAGGCCTCCCTGGCCTGG - Intergenic
1143420727 17:6789714-6789736 TTGGCAAGTCTAACCTGCCCTGG + Intronic
1146960439 17:36970824-36970846 TTGAAAAGACTATCCAGGCCGGG - Intronic
1148717550 17:49726679-49726701 TTCAAAAAGCTAACCTGGCCAGG + Intronic
1149496211 17:57119416-57119438 TTAAAAAGCCTATCCTGGCCAGG + Intronic
1149824829 17:59818473-59818495 TTTAAAAGGCTAAACTGGCCAGG + Intronic
1150015231 17:61550216-61550238 ATGCAAAAGATAACTTGGCCTGG + Intergenic
1152123274 17:78431874-78431896 TTAAAAATCCTAACCTGGCCAGG + Intronic
1153401409 18:4687462-4687484 TTGAAGAGGATAACATGGCCAGG - Intergenic
1155904815 18:31437221-31437243 TTCAAAAGGCTAACCAGGACAGG - Intergenic
1158847127 18:61456268-61456290 ATGCAAAGCGTGACCTGGCCTGG + Intronic
1162207919 19:9069996-9070018 TTGAAAAGAGGAACCTGGCCAGG - Intergenic
1162498112 19:11034747-11034769 TTTCAGTGGCTGACCTGGCCTGG - Intronic
927073776 2:19556118-19556140 TGGCAAAGGCTAACTGAGCCAGG + Intergenic
929604826 2:43227098-43227120 TTGCAAAGGGTGCCCCGGCCAGG + Intergenic
929620721 2:43351356-43351378 TTACAAATGCTTTCCTGGCCAGG + Intronic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
930072856 2:47382389-47382411 TTGTAAAGGTGAATCTGGCCAGG + Intronic
931318188 2:61151919-61151941 TGGCAAAGGCCACCCTGCCCTGG + Intronic
932436782 2:71706414-71706436 CTGCAAGGGCCAACATGGCCAGG - Intergenic
933019377 2:77172299-77172321 TTTAAAGGGCTAAACTGGCCAGG + Intronic
933843550 2:86306907-86306929 TTGAAAAGCCACACCTGGCCAGG + Intronic
934095310 2:88596606-88596628 TTGCAAAGCCTGGCCTGGCGTGG - Intronic
935173913 2:100631352-100631374 TTACACAGGCTGACTTGGCCAGG + Intergenic
936556745 2:113503312-113503334 TTCCGAAAGCAAACCTGGCCCGG - Intergenic
939547340 2:143569598-143569620 TTGGCAAGGCCTACCTGGCCTGG - Intronic
943479884 2:188404831-188404853 TTGCATGGGCCAACCTGGCTTGG - Intronic
945296089 2:208172819-208172841 TTGCAAGAGATAACTTGGCCAGG + Intronic
946856030 2:223950543-223950565 TTACAAAGGTAAACCAGGCCAGG - Intergenic
1171892060 20:30725464-30725486 TTGCAAAGGCAGTGCTGGCCTGG - Intergenic
1172130395 20:32651038-32651060 TTGTAAAGGGAAAACTGGCCAGG + Intergenic
1173444840 20:43108364-43108386 TTCCAAAGGCTCAACTGGGCTGG - Intronic
1174667034 20:52268080-52268102 TTGAAAAGGCTTACTGGGCCAGG - Intergenic
1183419775 22:37704755-37704777 GTGCAAAGGCCAGCCTGGCACGG + Intronic
1183901162 22:41007070-41007092 TTTTAAAGGCTAACCCAGCCTGG + Intergenic
1184936084 22:47722972-47722994 TTGAAAAGGCTAACAAAGCCAGG + Intergenic
1185136975 22:49078834-49078856 TGGGACAGGCTAACCTGGGCTGG - Intergenic
949860330 3:8499475-8499497 GTGCAATGGCACACCTGGCCTGG - Intergenic
950163621 3:10777834-10777856 TTGCTAAGGCAAAGCTGGGCTGG + Intergenic
952366918 3:32683089-32683111 GGGCAAAGGCATACCTGGCCGGG - Intergenic
955375467 3:58392386-58392408 CAGCAAAGACTAATCTGGCCAGG + Intronic
958743509 3:98104936-98104958 CTGCAAAGGCTAAACTGCCGAGG - Intergenic
958776334 3:98487433-98487455 TTGCAGGGGCCAACCTGGCATGG - Intergenic
963506401 3:146190487-146190509 TTTTAAAGTCTATCCTGGCCCGG + Intergenic
968416388 4:438207-438229 TTGCCAAGGCTAACCTGCAGTGG - Intronic
979290227 4:118971724-118971746 TTGAAAAGGAAAAGCTGGCCAGG - Intronic
986331219 5:6717250-6717272 TTTTAAAGGCTCACCTGGGCTGG + Intronic
987086686 5:14476494-14476516 TTGAAAATGTAAACCTGGCCAGG + Intronic
991411560 5:66351273-66351295 TTGCCCAGGCTCACTTGGCCGGG + Intergenic
996213860 5:120843793-120843815 TTGCATGGGCTAAAATGGCCAGG - Intergenic
1001459342 5:171895958-171895980 CTGCAAAGGCTCATCTCGCCTGG - Intronic
1003723875 6:8736851-8736873 TTCAAAAGGCTAACATGGCAGGG - Intergenic
1003966767 6:11259297-11259319 TTCCAAAGGCCAACCTGGAAGGG + Intronic
1007260428 6:40559476-40559498 GTGGAGAGGCTAAGCTGGCCAGG + Intronic
1008875305 6:56319491-56319513 ATGCAAAAGTTAACCAGGCCTGG - Intronic
1016832507 6:148447791-148447813 TAGCAAGGGCTAAGGTGGCCAGG - Intronic
1020910197 7:14119583-14119605 TTGCAGAGGTTAGCATGGCCTGG + Intergenic
1021785614 7:24149244-24149266 TTGAAAAGTCTATTCTGGCCAGG + Intergenic
1023520112 7:41041381-41041403 TTGAAAAGACTGACCTGGCTGGG - Intergenic
1029274855 7:99397923-99397945 AAGCCAAGGCTGACCTGGCCCGG - Exonic
1029636482 7:101787895-101787917 TTACAAAAGTTAACCTGGCATGG - Intergenic
1030305621 7:108016195-108016217 ATACTAAGGCTAACCTAGCCAGG - Intergenic
1036204837 8:6797601-6797623 TAGCCAAGGCCAGCCTGGCCTGG + Intergenic
1036680894 8:10872714-10872736 AGGCAAAGTCTAACCTAGCCAGG + Intergenic
1040065856 8:43143341-43143363 ATGGAAAGGCTAATCTGGCTGGG + Intronic
1041983374 8:63890279-63890301 TTGCCCAAGCTCACCTGGCCAGG - Intergenic
1043934606 8:86129378-86129400 TTGAAAAGAATAATCTGGCCAGG + Intronic
1044726275 8:95196612-95196634 TGGCACAGTCTAAACTGGCCCGG - Intergenic
1047096228 8:121629003-121629025 GTGAAAAGGCTAACCTACCCTGG - Exonic
1047215484 8:122872767-122872789 TTGAAAAGTCTGAGCTGGCCTGG + Intronic
1048389830 8:133952199-133952221 CTGCAAAGGCTGAACTGGCCAGG + Intergenic
1049404271 8:142444696-142444718 CAGCAAAGGCAAACATGGCCAGG - Intergenic
1049896273 9:114026-114048 TTCCGAAAGCAAACCTGGCCCGG + Intergenic
1050162906 9:2736398-2736420 TTGAAGAGGCTCACTTGGCCAGG - Intronic
1052923395 9:33991956-33991978 TAGCAAATGATACCCTGGCCAGG + Intronic
1056195356 9:84223567-84223589 TTGCAAAGACAAAACTGACCTGG + Intergenic
1056730225 9:89159759-89159781 TTGAAAAGGCTAGACTGGCTTGG - Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186425782 X:9464216-9464238 TTGCAATGGCTTACACGGCCTGG - Intronic
1187353383 X:18542954-18542976 TTGCAGACGCTACCCTGGCCGGG + Intronic
1187490904 X:19750416-19750438 TTGCAGAGGCTAAACTGGGAGGG - Intronic
1188040063 X:25361483-25361505 TTGAAAAGGATGTCCTGGCCGGG + Intergenic
1189364294 X:40376479-40376501 TAGGAAGGGCTAACCTTGCCTGG + Intergenic
1189412259 X:40783014-40783036 TTGAAAAGGTTAACGAGGCCGGG - Intergenic
1190948394 X:55118386-55118408 TTCCAAAGGCTCCACTGGCCTGG + Intronic
1193414624 X:81206796-81206818 TTGGAAAGCCTAAACTGGTCTGG + Intronic
1194153785 X:90361743-90361765 TTGGAAAGGCTCACATGGCAAGG + Intergenic
1195321493 X:103725015-103725037 TTGCCAAGGCCACCCTGGACAGG + Exonic
1195840448 X:109170768-109170790 TTGCAAAGGCAAACCTTCCCTGG + Intergenic
1198394583 X:136208804-136208826 TTGCAAAGGCTAACCTGGCCTGG - Intronic
1200500132 Y:3938623-3938645 TTGGAAAGGCTCACATGGCAAGG + Intergenic
1201861332 Y:18600674-18600696 TTGAAAAGTTTGACCTGGCCGGG + Intergenic
1201871991 Y:18719706-18719728 TTGAAAAGTTTGACCTGGCCGGG - Intergenic