ID: 1198397455

View in Genome Browser
Species Human (GRCh38)
Location X:136234727-136234749
Sequence AGCCCTGGAAAAGATGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198397455_1198397460 26 Left 1198397455 X:136234727-136234749 CCTGGATCATCTTTTCCAGGGCT 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1198397460 X:136234776-136234798 TGGCTAATGACGCTTTTGTTGGG 0: 1
1: 0
2: 0
3: 20
4: 115
1198397455_1198397459 25 Left 1198397455 X:136234727-136234749 CCTGGATCATCTTTTCCAGGGCT 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1198397455_1198397458 6 Left 1198397455 X:136234727-136234749 CCTGGATCATCTTTTCCAGGGCT 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1198397458 X:136234756-136234778 TGAAGCAGCACTTCTGCTTCTGG 0: 1
1: 0
2: 4
3: 61
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198397455 Original CRISPR AGCCCTGGAAAAGATGATCC AGG (reversed) Intronic
900178564 1:1301650-1301672 AGGCCTGGAGCAGATGATCGGGG - Intronic
902047604 1:13537460-13537482 AGTAATGGAAAAGATGATTCGGG - Intergenic
902931355 1:19733753-19733775 AGCGCTGGGAAAGATGTTCAAGG + Intronic
903779236 1:25810887-25810909 AGCCCAGGAACAGCTGGTCCTGG - Intronic
904607737 1:31707175-31707197 AGCCCAGCAGAAGATGATCATGG - Intergenic
906237311 1:44219844-44219866 GGCCCTGGAACAGATGCTGCTGG + Exonic
908607344 1:65812915-65812937 AGCCCTGGAAAAGTTGCCCCAGG + Intronic
913682352 1:121198450-121198472 CTCCCTGGAGAAGATGACCCTGG + Intronic
914034189 1:143986079-143986101 CTCCCTGGAGAAGATGACCCTGG + Intergenic
914155257 1:145081891-145081913 CTCCCTGGAGAAGATGACCCTGG - Intronic
914372910 1:147045928-147045950 AGCCCTGGGAAAGATATTTCAGG - Intergenic
914434969 1:147651754-147651776 AGCCCTGGGAAAGATGAGTAGGG - Intronic
918447679 1:184631128-184631150 ATCCCTGACAAGGATGATCCAGG + Intergenic
920469664 1:206216968-206216990 CTCCCTGGAGAAGATGACCCTGG + Intronic
924900298 1:248390601-248390623 AGCCTCGGAAAAGCTGTTCCTGG - Intergenic
1064031687 10:11886986-11887008 AGCCCTGGCATAGATCATCGGGG - Intergenic
1064524455 10:16239716-16239738 GACTCTGGAAAAGATTATCCGGG + Intergenic
1065272182 10:24045843-24045865 AGCCCTAGAACAGAAGAGCCTGG + Intronic
1069808481 10:71141200-71141222 GGCCTTGGATAAGACGATCCAGG - Intergenic
1071297731 10:84234313-84234335 AGCCATCCAAAAGATGAACCAGG + Exonic
1071384983 10:85110800-85110822 AGCAATGGAAAAGATTATTCCGG - Intergenic
1073154446 10:101335296-101335318 AGCCCTGGAAAAGTTGCTGAAGG - Intergenic
1073432477 10:103495051-103495073 AGCCCTAGAAAAGAGGGTCTGGG + Intronic
1075498921 10:122954208-122954230 AGCACTGGAAGAGAGGTTCCGGG - Exonic
1076544897 10:131238673-131238695 AGCCCTGGCAAAGATTGTTCTGG + Intronic
1077908761 11:6556870-6556892 GGCCCTGGAAAGCATGACCCAGG + Exonic
1081567679 11:44270052-44270074 GGCTCTGGAACAGAGGATCCAGG + Intronic
1082802023 11:57421710-57421732 ACTCCTGGAAAAGAAGACCCTGG + Intronic
1084444811 11:69197328-69197350 ATCCCAGGAAAAGCTCATCCAGG - Intergenic
1084856056 11:71987322-71987344 AGCCTTGGAAAATATGATTTAGG - Intronic
1085555082 11:77412147-77412169 AGCCCTGGAAAACCTGGCCCTGG - Intronic
1087416327 11:97860782-97860804 AACCTTGGAGAAGATGAGCCAGG - Intergenic
1090208209 11:124897196-124897218 GGCCCTGGAACAGCTGGTCCTGG + Exonic
1091458938 12:629438-629460 AGACCTGGAAGACAGGATCCTGG - Intronic
1094426751 12:30324112-30324134 AGCCCTGGAAAAAATGCTCATGG + Intergenic
1101811606 12:108112561-108112583 AGCCCTGACAAAGAAGAGCCTGG + Intergenic
1104141849 12:125994947-125994969 ACAACTGGAAATGATGATCCAGG + Intergenic
1104856111 12:131903208-131903230 AGCCCTGGCAGAGGTGGTCCTGG + Intronic
1112776207 13:102846326-102846348 AGCGCTGGAAGGGAAGATCCTGG + Exonic
1113438177 13:110308679-110308701 GGCCCTGGAAGAGCTGCTCCGGG + Intronic
1113596967 13:111540218-111540240 AGCCCTGGGAAAAAGGAGCCCGG - Intergenic
1113827047 13:113263714-113263736 AGCCTTGTGAAAGATGACCCAGG - Intronic
1114070768 14:19104353-19104375 AGCCATGGACAAGATTAACCTGG + Intergenic
1114091493 14:19295653-19295675 AGCCATGGACAAGATTAACCTGG - Intergenic
1116776959 14:49192438-49192460 AGCCCTGGAAAAGTTGACATGGG - Intergenic
1121311038 14:92935069-92935091 TGCCCTGCAAAGGATGTTCCAGG - Exonic
1122889159 14:104724582-104724604 GGCCCTGGGAAAGGTGCTCCCGG - Intronic
1126560494 15:50037725-50037747 AGCCTTGGAAAGTGTGATCCTGG - Intronic
1126779306 15:52125062-52125084 AGGCAGGGAAAAGATGTTCCAGG + Intronic
1127229440 15:56972591-56972613 AGCCATAGAAAAGATAAGCCAGG + Intronic
1129540802 15:76346107-76346129 AGCCCTGGAAGAAATGTCCCAGG + Intergenic
1129884576 15:79029564-79029586 AGCCCTGGAAATGATGATTTGGG + Intronic
1131050316 15:89343350-89343372 AGCCCAGGTAAGGATGAGCCAGG - Intergenic
1133019472 16:2960850-2960872 GGCCCTGGGAGAGATGAACCAGG - Intergenic
1133287002 16:4695146-4695168 GGCCCTGGAGAAGTTGCTCCCGG + Exonic
1134189755 16:12111989-12112011 AGCCCTGGGAACGATGACCACGG - Intronic
1137004400 16:35259573-35259595 AAACCTTGAAAAGATGACCCAGG + Intergenic
1137599924 16:49749677-49749699 ATCCCTGGAAGAGATGACCATGG - Intronic
1142991854 17:3736607-3736629 TGTCCTGGAAAAGAGGGTCCTGG + Intronic
1143047845 17:4096896-4096918 TGCCCTGGGAAAGTTGAACCTGG - Intronic
1145258852 17:21342889-21342911 AGCACTGGAATAGAAGAGCCAGG + Intergenic
1145317772 17:21745115-21745137 AGCACTGGAATAGAAGAGCCAGG - Intergenic
1145930416 17:28681408-28681430 AGTGCTGGAAAAGAAAATCCAGG + Intronic
1146020611 17:29275359-29275381 AGAACTGGACAAGATTATCCAGG + Intronic
1146187350 17:30732306-30732328 AGAGCTGGAAAAGAGGGTCCGGG + Intergenic
1146332407 17:31937703-31937725 AGAGCTGGAAAAGAGGGTCCGGG + Intronic
1147255842 17:39181529-39181551 AGCCCTGGAGTAGAAGGTCCAGG + Intronic
1148441282 17:47712931-47712953 AGCCCTGGGAAAGAAGGTTCTGG + Intergenic
1149421421 17:56514148-56514170 AACCCTGGAAAAGAAGACCTGGG - Intergenic
1151409368 17:73911476-73911498 AGCCCAGGAGAAAATGGTCCAGG + Intergenic
1155046705 18:22109399-22109421 AGCACTGGAAAGGCTGAGCCAGG - Intergenic
1155726355 18:29089294-29089316 AGCCCTGAAAGAAATGATACAGG + Intergenic
1155827689 18:30468793-30468815 AGTCCTGGAAAAGATGATGGGGG + Intergenic
1155916896 18:31566029-31566051 AGCCATGGAAAAGGTGACTCTGG + Intergenic
1161619514 19:5290838-5290860 AGTCCTGGAAATGACGTTCCAGG - Intronic
1164732439 19:30516538-30516560 AGCCCTGGAGGAGATGATAATGG + Intronic
1168386359 19:55966420-55966442 CGCCCTTGAAAAGACCATCCGGG - Intronic
925127869 2:1474473-1474495 AGCCATGGAAAAGATGAAAAGGG - Intronic
925847236 2:8044873-8044895 AGGTCTGGACAAAATGATCCAGG - Intergenic
927102602 2:19799531-19799553 AGCCCTGGAACAGGGAATCCAGG + Intergenic
929532823 2:42763229-42763251 AGCCATGCCAAAGATGATGCTGG + Exonic
931208447 2:60169796-60169818 ATTCCTGGAAAAGATGATAATGG - Intergenic
933276715 2:80291841-80291863 AGCCCTGGTGAACCTGATCCTGG - Intronic
936484389 2:112914024-112914046 AACTCTGGGAAAGATGAGCCCGG + Intronic
938313104 2:130307524-130307546 AGTCCTGGAAGACATGATCTTGG + Intergenic
938617456 2:133013886-133013908 AGCAGTTGAAAAGATGCTCCAGG - Intronic
939487640 2:142835686-142835708 AGCCATGCAAATGATGATCTAGG - Intergenic
940159312 2:150694065-150694087 AGCCCTGGAAAAGAAGACTCCGG + Intergenic
942420199 2:175799096-175799118 TGCCCTGGATCAGATGATCCAGG + Intergenic
945091960 2:206184051-206184073 AGCCATGGAAAAGATGTTCCAGG - Intronic
945288558 2:208106421-208106443 AGAGCTGGAAAAGAGGACCCAGG - Intergenic
945959248 2:216114975-216114997 AGCCCGGGAAAAGATGGCGCCGG + Intronic
946221019 2:218227039-218227061 AGTCCTCGACAAGATGATCTTGG + Intronic
1169753743 20:9022120-9022142 AGCCCTGGAAAGGATTTTCTAGG - Intergenic
1173698154 20:45040588-45040610 AGACATGGACAAGATGAGCCTGG - Intronic
1174981076 20:55395596-55395618 AGCCCTGTAAAACATGAAACAGG - Intergenic
1175633282 20:60559875-60559897 AGCCTTGGAAAAGGCGATTCGGG - Intergenic
1177433716 21:21024017-21024039 ATCCCTTGAGAAAATGATCCAGG - Intronic
1178726513 21:35057258-35057280 AGCCATGGACAAGATGAACCTGG + Intronic
1179975401 21:44862718-44862740 AGCCCTGGGAAAGAAGGCCCAGG - Intronic
1180489232 22:15826818-15826840 AGCCATGGACAAGATTAACCTGG + Intergenic
1180907969 22:19428992-19429014 TGCCCTGGAGGAGATGATGCTGG - Intronic
1181323759 22:22029374-22029396 AGCACCAGAAAAGTTGATCCAGG + Intergenic
1181978712 22:26751329-26751351 AGTCCTTGAAAAGATGGTCCAGG + Intergenic
1182692713 22:32175224-32175246 AGCACTTGAGAAAATGATCCAGG - Intergenic
1183500289 22:38174833-38174855 AGCCCTGGACAAGTGGCTCCAGG - Intronic
951144631 3:19212700-19212722 AGCTCTGGCAAAGATAATTCAGG + Intronic
953625208 3:44565376-44565398 AGCCAGGGAAAAGAAGAGCCAGG - Intronic
956366076 3:68504424-68504446 AGCCCTAGTTAAGATGCTCCAGG - Intronic
956782407 3:72614457-72614479 AGCCATGGAAAAAATGGTCTTGG - Intergenic
960977107 3:123186103-123186125 AGTCCAGGAAGAGATGAGCCTGG - Intronic
961269087 3:125674246-125674268 AGCCCTGGTTAAGATCACCCGGG + Intergenic
961282644 3:125775716-125775738 AGCCCAGGAAAAGCTGCTCAGGG + Intergenic
963778683 3:149465227-149465249 AGCACTGGAAGAGAAGTTCCGGG - Intergenic
966196674 3:177320720-177320742 AGCTCTGGAAATCAAGATCCCGG - Intergenic
970780333 4:19730095-19730117 AGCCTGGGAAAACATGACCCTGG - Intergenic
976435086 4:85008816-85008838 ACCCCAGGAAAAGATGATGGTGG - Intergenic
977125223 4:93156840-93156862 AACTGTGGACAAGATGATCCAGG + Intronic
977778233 4:100948660-100948682 ATCCCTAGAAAAGTTGATCTTGG + Intergenic
979344055 4:119564793-119564815 AGCCCAGGAAAAGTTCATCATGG + Intronic
983792461 4:171814009-171814031 AGCACAGGAAAAGATGTTCAGGG + Intronic
983891540 4:173034846-173034868 ACCTCTGGAAAAGAAGCTCCAGG + Intronic
985867421 5:2524732-2524754 AGCTCTGGACAAGCTGGTCCTGG + Intergenic
986252392 5:6072277-6072299 AGCCCTGGAAAGCATTATGCGGG + Intergenic
986930734 5:12817545-12817567 AGCCATTGAAAAGATGAAGCAGG - Intergenic
988384312 5:30540558-30540580 AGCTCTGGGAAAGATGACACAGG - Intergenic
989467898 5:41778605-41778627 AGCATTGGAACAGATGATCATGG - Intronic
989590152 5:43105299-43105321 GGCCTTGGAAAAGATGATGAGGG + Intronic
990996092 5:61733485-61733507 AGCCCTGGTTTAGATGATGCAGG - Intronic
992986311 5:82234141-82234163 ATACCTGGAACAGATCATCCAGG - Intronic
993103443 5:83570137-83570159 TGGCCTGGAAAAGATGCTCAAGG - Intronic
996995145 5:129686727-129686749 TGCTCTGGCAAAGATGCTCCTGG - Intronic
999452275 5:151687135-151687157 AGCCCCGGAACAGATGAGGCAGG - Exonic
1000576245 5:162978961-162978983 AACCCTTGAAAAGAGGGTCCAGG - Intergenic
1002440639 5:179262630-179262652 AGCCCTGGGAAGGGTGTTCCAGG - Intronic
1003064695 6:2894069-2894091 ATCCCTGGAAAAGAGGATGTGGG + Intronic
1004541442 6:16554223-16554245 ATTCATGGAAAAGATGATCCTGG + Intronic
1006629190 6:35419055-35419077 AGGCCTGGAAAACATTAGCCTGG + Intronic
1006980014 6:38139884-38139906 AGCCCTGGAAAAAAAGATTCTGG + Intronic
1007777681 6:44232928-44232950 AGCCATGAAGAAGATGAACCAGG - Exonic
1010394039 6:75370155-75370177 AGCCCTAGAAAAGACAGTCCTGG + Intronic
1011786042 6:90846115-90846137 ATCCCTGGAAAATATAATCAGGG - Intergenic
1013832943 6:114296337-114296359 TGCCCTGGAAAAAAAAATCCTGG + Intronic
1016271430 6:142294700-142294722 AGCCTGAGAAAAGATGAGCCTGG - Intergenic
1017675656 6:156811144-156811166 AGCCCTTTAAAAGAGGGTCCAGG - Intronic
1021122694 7:16815072-16815094 CTCCCTGGACAAGAAGATCCAGG + Intronic
1023131587 7:37008718-37008740 AGCTCTGGAATAGCAGATCCAGG + Intronic
1024665422 7:51542216-51542238 AGCATGGGAAAAGATAATCCAGG - Intergenic
1025790315 7:64682003-64682025 AGCCCTGGGAAGAATGGTCCAGG - Intronic
1026711908 7:72749228-72749250 AGCCATTGAAAAGATGATAAGGG - Intronic
1027142373 7:75668048-75668070 AGCCCTGGAACAGGAAATCCAGG - Intronic
1028259435 7:88643071-88643093 AGTAGTAGAAAAGATGATCCTGG - Intergenic
1034212896 7:149380801-149380823 AGCCCTTTAAAAGAAGGTCCTGG + Intergenic
1036949693 8:13129339-13129361 AGCCATGGAAAAGAGGATCTTGG + Intronic
1037599354 8:20380895-20380917 AGCCCTGGAAATGAGGATGCCGG - Intergenic
1037612496 8:20488078-20488100 ATCCCTTGAAGAGATGAACCAGG - Intergenic
1038946058 8:32361478-32361500 AGCCATGGACAACATGTTCCAGG + Intronic
1039771682 8:40694172-40694194 AGCCCTGGAGAAGCTGCTGCTGG + Intronic
1042837442 8:73091325-73091347 AGCACTGAAATAGTTGATCCAGG - Intronic
1043550920 8:81371765-81371787 AGCCCTGGATGAGATCATCAAGG + Intergenic
1045353795 8:101366748-101366770 AGCCATGGACAAGATCAACCTGG - Intergenic
1045404095 8:101847929-101847951 GGCCCTTGAAAAGAAGATGCTGG + Intronic
1046396992 8:113653588-113653610 AGACCTGGAAAAGAAGGACCGGG + Intergenic
1047999785 8:130368939-130368961 AACCCAGGAAAAGATTAGCCAGG - Intronic
1048296934 8:133221295-133221317 AGCCCTGGAAAAGAAGAGTGGGG + Intronic
1049278328 8:141731120-141731142 TGCCCTGGAACAGGTGACCCAGG + Intergenic
1049958117 9:711891-711913 AGCCCTGGAGCAGAAGATCCAGG + Exonic
1051368142 9:16335791-16335813 ATCCCAGGAGAAGATGCTCCTGG + Intergenic
1051803281 9:20961441-20961463 AGCCCTGTAATAGATACTCCAGG + Intronic
1053381454 9:37652311-37652333 AGTCCTGGAAAAGATGAACTTGG - Intronic
1054894154 9:70288387-70288409 AGCCCTGGCAAATATGATAAGGG - Intronic
1056591400 9:87968551-87968573 AGGCCTGGAAGAGAGGACCCAGG - Intronic
1056816147 9:89802683-89802705 AGTTTTGGAAAAGATGATCCAGG + Intergenic
1057801369 9:98193032-98193054 AGCCCTGGATGTGACGATCCCGG + Intergenic
1058383616 9:104407604-104407626 ATGACTGAAAAAGATGATCCTGG - Intergenic
1059932448 9:119274311-119274333 AGCCCTGGAAAACAGGACCCTGG + Intronic
1061865037 9:133487795-133487817 TGCCCTGGAAAAGCCGAGCCGGG + Intergenic
1187248997 X:17580062-17580084 AGACCTTGAAAGGATGATTCAGG - Intronic
1189025612 X:37390692-37390714 AGCCCTGAAGAAGACGATCCTGG - Intronic
1189653171 X:43211594-43211616 TGCCCTGGAAGAGATGATAGTGG - Intergenic
1192305340 X:69953231-69953253 AGGACTGGAAAAGATGTTACAGG + Intronic
1193249556 X:79272989-79273011 AACCCTGGAAAAGAAGATGTAGG - Intergenic
1194976522 X:100402264-100402286 AGCCCTTGAAATCATTATCCTGG - Intronic
1195400990 X:104460885-104460907 AGCCCTTCACAAGATGAACCTGG - Intergenic
1195785696 X:108519427-108519449 TGCCCTGGAAAAACTGATCTAGG - Intronic
1196700162 X:118659362-118659384 AGCCCTGTAGAAGGTGGTCCTGG - Intronic
1198397455 X:136234727-136234749 AGCCCTGGAAAAGATGATCCAGG - Intronic