ID: 1198397457

View in Genome Browser
Species Human (GRCh38)
Location X:136234742-136234764
Sequence GCTGCTTCATTATCCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198397457_1198397460 11 Left 1198397457 X:136234742-136234764 CCAGGGCTGGATAATGAAGCAGC 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1198397460 X:136234776-136234798 TGGCTAATGACGCTTTTGTTGGG 0: 1
1: 0
2: 0
3: 20
4: 115
1198397457_1198397458 -9 Left 1198397457 X:136234742-136234764 CCAGGGCTGGATAATGAAGCAGC 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1198397458 X:136234756-136234778 TGAAGCAGCACTTCTGCTTCTGG 0: 1
1: 0
2: 4
3: 61
4: 452
1198397457_1198397459 10 Left 1198397457 X:136234742-136234764 CCAGGGCTGGATAATGAAGCAGC 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198397457 Original CRISPR GCTGCTTCATTATCCAGCCC TGG (reversed) Intronic
900491415 1:2951114-2951136 GCTGGTGCATCGTCCAGCCCAGG + Intergenic
904852357 1:33468551-33468573 GCTCCTGCACCATCCAGCCCTGG - Intergenic
906304228 1:44706321-44706343 GCTGCTTCATTCTCCTCACCAGG - Intronic
907881213 1:58550699-58550721 CCTGCTCCATTATCCTTCCCAGG - Intergenic
908060576 1:60343853-60343875 GTTGCTTGATTTTCCACCCCTGG + Intergenic
910248892 1:85172898-85172920 GCTGGTTCTTTCTCCAGCCTTGG - Intronic
910613660 1:89172327-89172349 TCTGCTTCATGATCCAATCCAGG + Intronic
913500114 1:119464824-119464846 GCTGCTACATCTTCCAGCACAGG + Intergenic
918429797 1:184447882-184447904 GGCCCTTCATTATCCAACCCTGG + Intronic
922993536 1:229937829-229937851 CCTGCTTCCTTCTCCATCCCCGG - Intergenic
924937479 1:248784254-248784276 TCTGCTTCACTGTCCAGCCTTGG + Intergenic
1063392574 10:5659884-5659906 CCTGCTCCACTTTCCAGCCCAGG + Intronic
1067238807 10:44473165-44473187 GCGGCTCCATTCCCCAGCCCAGG - Intergenic
1068969209 10:62945462-62945484 GCTGCTTGAAAATCCAGACCAGG - Intergenic
1069601774 10:69712509-69712531 GCCGCATCAATCTCCAGCCCCGG + Intergenic
1070746145 10:78935203-78935225 GTTGCATCAGTATCCAGCTCAGG - Intergenic
1071293600 10:84203926-84203948 GCTACTTCTTAACCCAGCCCAGG - Intronic
1074407603 10:113192581-113192603 CCTTCTTCATTATCCTCCCCTGG - Intergenic
1074978759 10:118602350-118602372 CCTGGATAATTATCCAGCCCTGG - Intergenic
1075225334 10:120624082-120624104 ACAGCTTCACTATGCAGCCCAGG - Intergenic
1075575056 10:123571908-123571930 GCTGCTGCTTTACCCGGCCCTGG - Intergenic
1076163325 10:128262788-128262810 GCCACTGCATTATCCAGCCTGGG + Intergenic
1077105457 11:840380-840402 GCTGCTCAATTATGCACCCCTGG - Exonic
1077574791 11:3374470-3374492 ATTGCTTCCTTCTCCAGCCCTGG - Intronic
1079483254 11:20906266-20906288 TCTTCTTCATGATCCAGTCCTGG - Intronic
1080717886 11:34821707-34821729 GCAACTTCATGACCCAGCCCTGG + Intergenic
1081911552 11:46703138-46703160 GCTGCCTCTTTGTCCAGCCCAGG - Exonic
1084760232 11:71266218-71266240 CCTGCCTCATTCACCAGCCCTGG + Intergenic
1085196153 11:74673026-74673048 GCTGCTTCCTTTTGCAGCCCTGG + Intergenic
1088032339 11:105266448-105266470 GCAGCTTCATTAACCACCCCAGG - Intergenic
1089395833 11:118135985-118136007 GGTGGTTCATTTCCCAGCCCTGG - Exonic
1091335396 11:134762415-134762437 CCGCCTTCATGATCCAGCCCCGG - Intergenic
1092710367 12:11330302-11330324 GCTACATCATGATCCACCCCTGG + Intergenic
1093650810 12:21643626-21643648 AATGCTTCATTCTCCATCCCAGG + Intronic
1100273331 12:93047220-93047242 GCTGCTCAATTAGCCAACCCTGG - Intergenic
1100893633 12:99154853-99154875 TCCCCTTCATTACCCAGCCCAGG + Intronic
1104738227 12:131153171-131153193 GCTGCTTTATGGACCAGCCCTGG + Intergenic
1104991189 12:132624687-132624709 GCTGGGCCATTAGCCAGCCCCGG - Exonic
1107130444 13:36888553-36888575 TCTGCCTCTTTATCCAGCTCTGG - Intronic
1107133895 13:36923270-36923292 TCTGCTTCATTCTGCAGGCCTGG - Intergenic
1108418408 13:50224419-50224441 GCTACTTCCTTATTCAGACCTGG + Intronic
1112597756 13:100824390-100824412 GCTGCTTTCCAATCCAGCCCTGG - Intergenic
1113374379 13:109750616-109750638 GCTGCCTAATTAACCAGCCCTGG + Intergenic
1114674882 14:24433053-24433075 GCTCCTTCAATATCAAGCCTGGG - Intronic
1114893808 14:26960424-26960446 GCTGATGCATTATCCATCCAGGG + Intergenic
1117799480 14:59428320-59428342 GCTGCTTCATGGTCCAACCAGGG - Intergenic
1121284891 14:92727481-92727503 ACTGCTTAATTAGCCAACCCTGG + Intronic
1121316390 14:92963546-92963568 TCTGCTGCATGCTCCAGCCCAGG + Intronic
1121603303 14:95222208-95222230 GCTGCTAAATCATCCAGCCGAGG + Intronic
1122874615 14:104658176-104658198 GCTGGTTCACGATCCGGCCCAGG + Intergenic
1123945344 15:25236289-25236311 GCTCCTTCGTGATGCAGCCCAGG + Intergenic
1125549727 15:40536482-40536504 GCTGCTCCATTCTGCATCCCAGG + Intronic
1125950183 15:43745814-43745836 GGTTCTTCTTTGTCCAGCCCCGG - Intergenic
1126332202 15:47545287-47545309 GCTGCTAAATTATCCATCACTGG + Intronic
1130414076 15:83673562-83673584 GATGCTTCATTGGCCAGCCCTGG + Intronic
1131559462 15:93426871-93426893 GATGCTCCACTGTCCAGCCCGGG - Intergenic
1137476336 16:48812580-48812602 GCTGCTTCCTCATCCTGCCCTGG + Intergenic
1138222330 16:55263350-55263372 GCTCTTTCATCTTCCAGCCCTGG - Intergenic
1140802318 16:78499719-78499741 GTAGCTCCAGTATCCAGCCCAGG + Intronic
1142678123 17:1528179-1528201 GCTGCTGCACTGTCCAGCCTTGG - Intronic
1144455520 17:15415257-15415279 TCTGCTCCCTTATTCAGCCCTGG + Intergenic
1144533146 17:16059736-16059758 GCTGCATCTGTGTCCAGCCCAGG - Intronic
1145972447 17:28964331-28964353 TCTGCTCCACTAACCAGCCCAGG - Intronic
1150282124 17:63934775-63934797 CCTGCCTCCTTCTCCAGCCCAGG + Intergenic
1151745417 17:76009213-76009235 TCTGCTTCTTTCTCCAGCACCGG + Exonic
1155030720 18:21981247-21981269 CTTGCTTCATTCTGCAGCCCAGG - Intergenic
1155732504 18:29178914-29178936 GCTACTGCATTCTCCAGCCTAGG - Intergenic
1158539454 18:58339663-58339685 GCTGCTTCATGATCTTACCCAGG + Intronic
1161590876 19:5128647-5128669 GCTGCTCCAGCTTCCAGCCCTGG + Intronic
1163695502 19:18761452-18761474 GCCGGTTCATTCTCCAGCTCTGG - Intronic
1165052459 19:33150752-33150774 ACTGCTCCATGATCCGGCCCAGG + Intronic
1165114818 19:33522397-33522419 GCTTCTCCATTCTGCAGCCCAGG - Intergenic
1167389658 19:49186246-49186268 ACTGCTTCAATATACAGCCACGG - Intronic
1168145130 19:54416202-54416224 GCCCCTTCATTTTCCAGCCCTGG - Intronic
925282554 2:2694960-2694982 GCCGCTTCCTTATCCTGCCATGG + Intergenic
925316612 2:2931544-2931566 GCTGACTCATCATCCAGCACAGG + Intergenic
926125563 2:10269852-10269874 GCTGCTTCATTCTCCCCTCCAGG + Intergenic
926361355 2:12090724-12090746 GCTGCCTCAGGATCAAGCCCAGG + Intergenic
926686284 2:15700487-15700509 ACTGCTTAATTAACCAGCCCTGG + Exonic
927881512 2:26692863-26692885 GCCGCTTCATCGTCCCGCCCGGG - Exonic
929588628 2:43131344-43131366 GCTGTTTCCTGAGCCAGCCCCGG - Intergenic
929777255 2:44937175-44937197 GCTGTCTCAGGATCCAGCCCAGG - Intergenic
931947503 2:67326636-67326658 GCTGCTGAATCAACCAGCCCTGG - Intergenic
937449569 2:121990985-121991007 ACTGCCTCATTATTCTGCCCTGG + Intergenic
941233591 2:162941673-162941695 GCTGCTTAAGTCTCCAGCCCTGG - Intergenic
942255016 2:174088132-174088154 GTTACTTAATTAACCAGCCCTGG - Intronic
945143828 2:206715381-206715403 GATGCATCCTTATCCAGCACAGG + Intronic
946476122 2:220008111-220008133 TCTGCTTCCTTATCCAGGCAAGG - Intergenic
947353562 2:229271034-229271056 GCTGCCACATCTTCCAGCCCTGG + Exonic
1170332899 20:15234795-15234817 GCATTTTCATTTTCCAGCCCTGG - Intronic
1170673085 20:18453227-18453249 GCAGCTTCAATGTCCAACCCTGG + Intronic
1174050258 20:47762736-47762758 GCTCCATCTTTACCCAGCCCAGG - Intronic
1174665203 20:52251556-52251578 GTGGCCTCATTAACCAGCCCTGG + Intergenic
1178621744 21:34183331-34183353 ACTCCTTCATGATCCATCCCAGG + Intergenic
1178866222 21:36329684-36329706 CCTGCTTCATTATACTGCTCTGG + Intronic
1179408955 21:41147503-41147525 TCTGCTTCATTATCCTCTCCTGG - Intergenic
1179882091 21:44297131-44297153 GCAGCTCCATTACCCAGCGCTGG - Intronic
1181130062 22:20726095-20726117 GGTGCTTCGCTATGCAGCCCTGG + Intronic
1181745976 22:24955106-24955128 GCTCCTTCATTCTCCTGCCAAGG - Intronic
1183238210 22:36636222-36636244 CCTTCTCCATAATCCAGCCCCGG + Intronic
1184981105 22:48096608-48096630 GCTGCGTTATTCTCCTGCCCAGG - Intergenic
1185170712 22:49292134-49292156 GCAGCTGCATTACACAGCCCAGG + Intergenic
951429558 3:22590302-22590324 ACTGCTTCATTATCCATCTCTGG + Intergenic
953477079 3:43214656-43214678 GCTGCCTCCTCATCCAGCCCTGG + Intergenic
954328037 3:49874279-49874301 GCTGCTGCAGCACCCAGCCCAGG - Intergenic
954609704 3:51937815-51937837 CTTCCTGCATTATCCAGCCCTGG - Intronic
957732709 3:84162048-84162070 GCTTCTTCATTATCCATCAGTGG + Intergenic
958697077 3:97541541-97541563 GCTGCTCCAGGATCCAGTCCAGG + Intronic
958796872 3:98715619-98715641 GCTGCTAAATTATCCAAACCTGG - Intergenic
961308088 3:125973313-125973335 GCTGCATCCTAATCCAGACCAGG - Intronic
969494639 4:7519682-7519704 CCTGCTTCCTTAGCCAGCACTGG + Intronic
969587537 4:8103137-8103159 GTTGTTTAATTAGCCAGCCCTGG + Intronic
973705395 4:53575680-53575702 CCTCCTTGATTAGCCAGCCCAGG - Intronic
976219065 4:82741493-82741515 GCAGCTGCATGAGCCAGCCCAGG + Intronic
977730174 4:100341729-100341751 TCTGCTTCACTATTCATCCCAGG - Intergenic
979028651 4:115610113-115610135 TCTGCTTAATTCTCCAGGCCTGG - Intergenic
985281811 4:188294460-188294482 GCTGCTTCATTATCATTCTCAGG - Intergenic
985958825 5:3284197-3284219 GGTGCTGCATTGTCCAGCCCAGG + Intergenic
986659422 5:10045660-10045682 GCTCCCTCATTATCCACCCAGGG + Intergenic
987063026 5:14260893-14260915 GTTGATTCATTTTCCAGCCCTGG - Intronic
990989753 5:61673484-61673506 CCTGCTCCAAGATCCAGCCCAGG + Intronic
994211751 5:97094954-97094976 GCTCCTTCATGATCCAGTCCAGG + Exonic
995016548 5:107316261-107316283 GCTGCTTCCTTTTTCAGTCCTGG - Intergenic
996095195 5:119391199-119391221 GCTGCTTCAAAATCCAGACTGGG - Intronic
997675403 5:135708988-135709010 GCTGCTTGACTATCCTGCCAAGG + Intergenic
1001085939 5:168700161-168700183 TCTGCTTCTTTAGCCTGCCCAGG + Intronic
1002962635 6:1930496-1930518 GTTGCTTCAATATGCAACCCAGG + Intronic
1003788563 6:9516101-9516123 GCTGTTTAATTAGCCAGCCTGGG - Intergenic
1011872918 6:91919819-91919841 CCTGGTTCAGGATCCAGCCCCGG - Intergenic
1012539495 6:100344859-100344881 CCTGCTACCTTAGCCAGCCCTGG + Intergenic
1016859350 6:148701243-148701265 GCTGCTTCTGTCTCCTGCCCAGG - Intergenic
1018025248 6:159800507-159800529 GGGGCTTCCTTCTCCAGCCCCGG + Intronic
1018275422 6:162125231-162125253 CATGCTTCAGAATCCAGCCCCGG + Intronic
1018656673 6:166043346-166043368 GCAGCTTCATTTTACAGACCAGG - Intergenic
1021488380 7:21191754-21191776 GCAGCTTCATTATTTAGCCCTGG + Intergenic
1023660595 7:42467463-42467485 GGTGATTGATTATCCAGACCTGG - Intergenic
1026737657 7:72959366-72959388 GCTACTGCATGATCCAGCCTGGG - Intergenic
1026788692 7:73318167-73318189 GCTACTGCATGATCCAGCCTGGG - Intronic
1027106076 7:75405702-75405724 GCTACTGCATGATCCAGCCTGGG + Intronic
1031072131 7:117173536-117173558 GCTGGTTCCTTATCTGGCCCTGG + Intronic
1034820190 7:154210156-154210178 GCTGCCTCCTTGTCCAGCCAAGG + Intronic
1039609068 8:38904518-38904540 GCTGCCTCTTGATCCAGCCATGG - Intronic
1041086030 8:54257298-54257320 GCTGCTCCAGAATCCAGCACTGG + Intergenic
1041799479 8:61783778-61783800 GATGCTGCATTATTCAGCCCAGG - Intergenic
1042883450 8:73520824-73520846 GCTGCTTTATCAACCAACCCTGG + Intronic
1043647835 8:82544707-82544729 GCTGCTGCACTCTCCAGCCTAGG + Intergenic
1045336197 8:101205913-101205935 GCGGCTTCTTCACCCAGCCCTGG + Intronic
1045519949 8:102894841-102894863 GCAGCCTCATTCTCGAGCCCTGG - Intronic
1046830582 8:118741507-118741529 GGAGTTTCATAATCCAGCCCAGG - Intergenic
1048859083 8:138710337-138710359 TCTGCTTCTTGAACCAGCCCAGG + Intronic
1049725219 8:144142645-144142667 GGGGCTTCCTTCTCCAGCCCTGG + Intergenic
1050096759 9:2075185-2075207 ACTCCTTCATTTTCCAGGCCAGG - Intronic
1050279132 9:4032674-4032696 GCTTCAACATTTTCCAGCCCGGG + Intronic
1052349702 9:27445948-27445970 GTTTCTACATCATCCAGCCCAGG - Intronic
1055050693 9:71977090-71977112 GCTGCTGAACTAACCAGCCCTGG + Intronic
1057714756 9:97483210-97483232 GCTACTTCGTCATCCAGCCTTGG + Exonic
1062333288 9:136053856-136053878 GCTGCTGCCCTACCCAGCCCAGG - Intronic
1186447972 X:9648057-9648079 GCTGCACCACTATCTAGCCCTGG - Intronic
1189053514 X:37672460-37672482 GCTGCTTCATTTTACACCGCAGG - Intronic
1193183537 X:78485850-78485872 ACTAATTCAATATCCAGCCCTGG - Intergenic
1196193604 X:112818449-112818471 TCTGCTTCCTTTTCCAGCCTGGG - Intronic
1196677194 X:118432144-118432166 GCTGCTGAATTAACCAACCCTGG - Intronic
1198397457 X:136234742-136234764 GCTGCTTCATTATCCAGCCCTGG - Intronic
1200952589 Y:8914752-8914774 GCTGCATCATTTTCCATTCCAGG + Intergenic