ID: 1198397459

View in Genome Browser
Species Human (GRCh38)
Location X:136234775-136234797
Sequence CTGGCTAATGACGCTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198397455_1198397459 25 Left 1198397455 X:136234727-136234749 CCTGGATCATCTTTTCCAGGGCT 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1198397457_1198397459 10 Left 1198397457 X:136234742-136234764 CCAGGGCTGGATAATGAAGCAGC 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198397459 Original CRISPR CTGGCTAATGACGCTTTTGT TGG Intronic
903288318 1:22290979-22291001 CTGGCTGATGTCGCTGGTGTGGG + Intergenic
910954958 1:92693027-92693049 CTTTCTAATGAAGCTTTTTTTGG - Intronic
922928132 1:229367673-229367695 CTGACAAATGAGGCTTTTGTAGG + Intergenic
924345330 1:243068301-243068323 CTGGCTAATGTTTCTTTTTTTGG - Intergenic
924833960 1:247629204-247629226 CTGGCAAATGTCGCTATGGTAGG - Intergenic
1065356479 10:24846693-24846715 GTGGCTCATGACGCTTCTGGAGG + Intergenic
1066731004 10:38436508-38436530 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1070933274 10:80275402-80275424 CTTGCTAATGAAGCTTTGGCAGG - Intronic
1074997591 10:118771141-118771163 CTGGCAAATATCTCTTTTGTGGG + Intergenic
1077914431 11:6602067-6602089 CTGGCAAATGATGCCTTTTTGGG + Exonic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1090193396 11:124793516-124793538 GTGGCTAGTGACTGTTTTGTTGG - Intronic
1091133926 11:133170853-133170875 CTGGCTAATTGTGCTTTTGGGGG - Intronic
1098002730 12:65962202-65962224 CTCACTAACGACGCTTTTATCGG + Intronic
1098574411 12:72024712-72024734 CTGGTTAATGAGGCATGTGTGGG + Intronic
1103774032 12:123352290-123352312 TTGGCTAATGCCATTTTTGTAGG - Intronic
1108434140 13:50385207-50385229 TTGGCTAAAGAAGGTTTTGTAGG + Intronic
1120825709 14:88953076-88953098 CTGGCCGATGAAGCCTTTGTTGG + Intergenic
1122593871 14:102875043-102875065 CAGGCTAATGCTGCTTTTTTTGG + Intronic
1129741334 15:77991082-77991104 CTGGCTGAGGACTCTTTTCTAGG - Intronic
1130730077 15:86482822-86482844 TTGGCTGATGAAGCTTTTGTTGG - Intronic
1133988305 16:10685005-10685027 CTGGCTAATGAGGCTCTGGCTGG + Intronic
1135167959 16:20157098-20157120 GTGGCAAATGAGGCATTTGTTGG - Intergenic
1153487190 18:5611603-5611625 CTCTCTAATGAAGCTTTTCTTGG - Intronic
1156791659 18:40983113-40983135 CATGCTACTGACTCTTTTGTTGG - Intergenic
1160917322 19:1503482-1503504 CTGGCTCATGAGGCTACTGTCGG - Intergenic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
931014146 2:57956122-57956144 GTGGCTAATGCCGCTTTGGGAGG + Intronic
935502303 2:103856539-103856561 ATGTCTCATGAGGCTTTTGTGGG + Intergenic
937603295 2:123766870-123766892 CTGGCTGAAGCAGCTTTTGTAGG + Intergenic
939979808 2:148766578-148766600 CTGGAAAATTACTCTTTTGTAGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG + Intronic
1179583286 21:42358604-42358626 CTCCCTAATGACGTTCTTGTTGG + Intergenic
1182666070 22:31960919-31960941 CTTGATAATGAAGCTATTGTTGG + Intergenic
1183325817 22:37193125-37193147 ATGGCTAATGGCAGTTTTGTGGG - Intronic
960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG + Exonic
972458861 4:39280491-39280513 CTGGCTAATTATTTTTTTGTAGG - Intronic
975726194 4:77294095-77294117 ATGGCTAATGACTCTATTCTGGG + Intronic
979257385 4:118619377-118619399 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
979330966 4:119421171-119421193 CTGGCTAATGTTTCTTTTTTTGG - Intergenic
979679694 4:123446044-123446066 CTTGGTACTGACTCTTTTGTGGG + Intergenic
996585263 5:125080487-125080509 ATCGCTAATGATGCTTTTCTCGG + Intergenic
996598399 5:125231576-125231598 CTGGCTATTAAGACTTTTGTTGG + Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG + Intergenic
1011254612 6:85407681-85407703 TTGGCTAATGCTGCTCTTGTGGG + Intergenic
1024072306 7:45796458-45796480 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1029873921 7:103727458-103727480 GTGGCTAATGAGCCTTTTTTTGG - Intronic
1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG + Intergenic
1045116183 8:98983293-98983315 CTGGCTATTCAACCTTTTGTTGG + Intergenic
1045323224 8:101097633-101097655 CAGTCAAATGCCGCTTTTGTTGG + Intergenic
1048346511 8:133579707-133579729 TTGCCTAATGACGCTTTTCTTGG + Intergenic
1052891573 9:33705060-33705082 CTGGCTTAGGACGCTTTTCAAGG + Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1059180158 9:112204423-112204445 CTGGCTATTCAGGCTTTTTTAGG + Intergenic
1060102382 9:120851877-120851899 CTTGCTAAAGAGGATTTTGTTGG + Intergenic
1186789127 X:12980096-12980118 CTGGCTTCTGAGACTTTTGTAGG + Intergenic
1191033181 X:55997255-55997277 CTGGCTAATGATGCTTCTCTAGG - Intergenic
1192733636 X:73826978-73827000 TTGGCTCTTGAGGCTTTTGTTGG + Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1201428101 Y:13876026-13876048 ATGGCTAAAGATGCTTTTGCTGG - Intergenic