ID: 1198398802

View in Genome Browser
Species Human (GRCh38)
Location X:136250830-136250852
Sequence CCCGCAGGGACTCCGCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 104}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198398802_1198398816 26 Left 1198398802 X:136250830-136250852 CCGGCGCGCGGAGTCCCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1198398816 X:136250879-136250901 GTTCGTTGGGGCGGTTGCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 24
1198398802_1198398812 13 Left 1198398802 X:136250830-136250852 CCGGCGCGCGGAGTCCCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1198398812 X:136250866-136250888 CAGGCAGCTGTGCGTTCGTTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1198398802_1198398811 12 Left 1198398802 X:136250830-136250852 CCGGCGCGCGGAGTCCCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1198398811 X:136250865-136250887 CCAGGCAGCTGTGCGTTCGTTGG 0: 1
1: 0
2: 0
3: 3
4: 91
1198398802_1198398813 14 Left 1198398802 X:136250830-136250852 CCGGCGCGCGGAGTCCCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1198398813 X:136250867-136250889 AGGCAGCTGTGCGTTCGTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 63
1198398802_1198398815 25 Left 1198398802 X:136250830-136250852 CCGGCGCGCGGAGTCCCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1198398815 X:136250878-136250900 CGTTCGTTGGGGCGGTTGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 19
1198398802_1198398814 17 Left 1198398802 X:136250830-136250852 CCGGCGCGCGGAGTCCCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1198398814 X:136250870-136250892 CAGCTGTGCGTTCGTTGGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 86
1198398802_1198398817 29 Left 1198398802 X:136250830-136250852 CCGGCGCGCGGAGTCCCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1198398817 X:136250882-136250904 CGTTGGGGCGGTTGCGCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 104
1198398802_1198398806 -6 Left 1198398802 X:136250830-136250852 CCGGCGCGCGGAGTCCCTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1198398806 X:136250847-136250869 TGCGGGCGCCCGCACATCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198398802 Original CRISPR CCCGCAGGGACTCCGCGCGC CGG (reversed) Intronic
907482490 1:54754657-54754679 CCCGCAGGGTCTCCAGGCGAGGG + Intergenic
918430933 1:184460025-184460047 CCCACAGGGACTCCACACACGGG + Intronic
1065534245 10:26701737-26701759 CCAGCAGGGACTCCGTGTGGGGG - Intronic
1068120419 10:52778582-52778604 CCAACAGGGACACCGCGCTCCGG - Intergenic
1076699546 10:132264392-132264414 GCCGCAGGGACCCCTCGAGCTGG + Intronic
1078855116 11:15200883-15200905 CCCCCAGGCGCTCCGCACGCTGG + Exonic
1083846041 11:65334130-65334152 CCCGCAGGGATGCCGCCCGTCGG - Intronic
1085297904 11:75441295-75441317 CCCACAGGGACTACGCGTCCTGG - Exonic
1090013120 11:123062413-123062435 GGCGCAGCGAGTCCGCGCGCGGG + Intronic
1090709778 11:129374401-129374423 CCCGCCGAGCCTCCGCGCCCGGG - Intergenic
1091688995 12:2583146-2583168 CCCGCAGCGGCGCCGCGCTCCGG + Intronic
1093894787 12:24563195-24563217 CCGGCAGGGAGGGCGCGCGCGGG + Intergenic
1097248956 12:57621869-57621891 ACCGCAGGGTCTGCGCGGGCAGG - Intronic
1102136814 12:110582743-110582765 CTCCCGGGGACTCCCCGCGCGGG - Intronic
1103900527 12:124301488-124301510 CCCGCAGGGAGGCCGAGCACTGG - Intronic
1103934148 12:124466431-124466453 ACCCCAGGGACTCCGCACCCGGG + Intronic
1103949709 12:124544091-124544113 CCCGCTGGGGCTCCCCGGGCAGG - Intronic
1105011951 12:132761942-132761964 CTCGCCGGGCCTCCGCGAGCGGG - Intergenic
1114566341 14:23635846-23635868 CCAGCAGGGGCTCCGTGGGCCGG + Intronic
1115474539 14:33800554-33800576 CCCGCGGGGACGCCGAGAGCGGG - Exonic
1115664643 14:35534092-35534114 CCCGCCGGGCCTCCCCGGGCTGG - Exonic
1117842139 14:59870712-59870734 CCCGGAGGGACTCGGCGCTCAGG + Exonic
1117911605 14:60642586-60642608 CTCTCAGGCACTCCGCGGGCCGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118607529 14:67514840-67514862 CCCGCAGGGAATCCAAGCCCCGG + Intronic
1121253099 14:92513954-92513976 CCCGTGGGGTCCCCGCGCGCGGG - Exonic
1127480245 15:59371780-59371802 CCCCGAGGGTCTCCGCGCCCCGG - Intronic
1129302545 15:74633884-74633906 CCCACAGGGACTCCCCCCGGTGG - Intronic
1132099821 15:99015249-99015271 CCCCCGGGGACACCGGGCGCCGG + Intergenic
1132348351 15:101121895-101121917 GCAGCAGGGACTGCGCGGGCTGG + Intergenic
1132898946 16:2243130-2243152 CCTGCAGGGCCTCCGCCGGCGGG + Exonic
1135040849 16:19115481-19115503 CCCACAGTGCCTCCGCACGCAGG - Exonic
1135775993 16:25257893-25257915 CCCGCCAGGACGCCTCGCGCGGG - Exonic
1140517716 16:75556218-75556240 CTCGCAGGCACTCCGCGAGCCGG + Exonic
1142188442 16:88706050-88706072 CGCGCGGGGACTCGGGGCGCCGG - Intronic
1142810399 17:2393235-2393257 CCGGCGGGGCTTCCGCGCGCCGG - Intronic
1144586763 17:16492001-16492023 CCCGCCGGGACTCTCCGCTCTGG + Exonic
1144775260 17:17781995-17782017 CTCGCAGCCACTCTGCGCGCGGG + Intronic
1146098385 17:29954656-29954678 CCAGCAGGGACTCTGCGTGGGGG - Intronic
1146126750 17:30237009-30237031 CCCGCGCGGACTCCACCCGCTGG - Intergenic
1148122642 17:45221938-45221960 CCCGATGGGACGCCGCGCTCCGG + Exonic
1152663207 17:81552473-81552495 GCTGCAGGGACTCCGGGAGCTGG + Intronic
1154311101 18:13266636-13266658 GCCGCAGGGCCTCCACGCTCAGG + Intronic
1157894274 18:51449095-51449117 CGTGCAGAGACTCCCCGCGCAGG + Intergenic
1160868805 19:1267779-1267801 CCCGCATGGACGGCGGGCGCAGG + Intronic
1160935405 19:1592354-1592376 CGCACTGGGCCTCCGCGCGCCGG + Intronic
1161265062 19:3360057-3360079 CCCCCACGGACTGCGCGCTCGGG - Intronic
1161350020 19:3786210-3786232 CCAGGAGGGCCTCCGCGAGCCGG + Intronic
1165433887 19:35786663-35786685 CCTGGAGGGACTCCGGGGGCTGG + Intronic
1166551756 19:43670136-43670158 CGTGCAGGGACCCCGCGCACAGG - Exonic
927054853 2:19358465-19358487 GCCGCGGGGACTCCAAGCGCCGG + Exonic
932440371 2:71731085-71731107 CCCGCAGGGGCGCCCGGCGCCGG - Intergenic
937065069 2:119011600-119011622 CCTGCAGCGACCCCGCGTGCCGG - Intergenic
937305242 2:120866941-120866963 CCCGCAGGGACTCCACTTCCAGG + Intronic
947992173 2:234496707-234496729 CCCGCGGGGACGCCGAGCCCCGG - Exonic
948585390 2:239015823-239015845 GCCGCAGGGGCTCAGCCCGCTGG - Intergenic
948835225 2:240623117-240623139 CCCACAGCGACTCCGGCCGCGGG - Intronic
1170363773 20:15577627-15577649 CACGCAGGGAGTACGCACGCAGG - Intronic
1170889747 20:20367690-20367712 CCCGCGGGTAATCCCCGCGCGGG + Intergenic
1171160907 20:22922292-22922314 CCTCCAGGGACTCCGTGCACTGG + Intergenic
1171263116 20:23750142-23750164 CCAGCAGGGACTCAGCGCCCTGG + Intronic
1175367753 20:58467364-58467386 CCGGCCGGGACTGCGCGCGGCGG - Exonic
1181457873 22:23070084-23070106 CCCGCAAGAGCTCCCCGCGCCGG - Intronic
1183742779 22:39677937-39677959 CCCGCAGGCACTCCGCCATCGGG + Intronic
951906516 3:27712892-27712914 TTCGCAGGGCTTCCGCGCGCCGG - Intergenic
961182545 3:124887550-124887572 CCCGTAGGGCCTCCGCGTCCCGG - Intronic
962240355 3:133746560-133746582 CCTGCATGCACTCCGCGCTCAGG + Intronic
968093204 3:195910357-195910379 GCCGCTGGGAATCCGAGCGCTGG - Intronic
968671700 4:1855735-1855757 CCCGCAGGGGCTCCGGAGGCCGG + Intronic
985129727 4:186727005-186727027 GCCGGAGGGGCTCCGCGAGCCGG - Intergenic
985538325 5:476490-476512 CCCGCAGGGACCCCGTGGGGCGG - Intronic
997266241 5:132496848-132496870 CCCGCCGGGGTTCGGCGCGCAGG + Intergenic
999374970 5:151080740-151080762 CGCCCCGGGACCCCGCGCGCCGG + Intronic
1011517061 6:88166303-88166325 GCGGCAGGGACTGCGCGAGCGGG - Exonic
1016590219 6:145735522-145735544 GCCGCGGGGACTCCGGGCCCGGG - Exonic
1019446294 7:1073361-1073383 CCGGCAGCTACTCCCCGCGCAGG + Intronic
1028983460 7:96992436-96992458 CTCGCCGCGACGCCGCGCGCGGG + Intergenic
1029996536 7:105013197-105013219 CCCGCAGCGACCCAGAGCGCTGG - Intergenic
1037947650 8:22999388-22999410 CCCGCAGCGACGCCGCGGGGAGG - Intronic
1038266190 8:26041414-26041436 CCCGCGAGGACTGCGCACGCAGG + Intronic
1039436737 8:37564537-37564559 CCCTCAGGGTCCCCGTGCGCTGG - Intergenic
1040573013 8:48625881-48625903 ACCGCAGGGACTCCCAGTGCTGG + Intergenic
1042246385 8:66712746-66712768 CCGGCAGGGCCGCCGGGCGCCGG - Intronic
1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG + Exonic
1049668312 8:143858655-143858677 CCCGCAGGGTCTCGGGGCCCAGG + Exonic
1049668728 8:143860254-143860276 CCCGCAGGGTCTCGGGGCCCAGG + Exonic
1049669143 8:143861856-143861878 CCCGCAGGGTCTCGGGGCCCAGG + Exonic
1049669558 8:143863458-143863480 CCCGCAGGGTCTCGGGGCCCAGG + Exonic
1049669968 8:143865051-143865073 CCCGCAGGGTCTCGGGGCCCAGG + Exonic
1051896778 9:21995781-21995803 CTCGCCGGCTCTCCGCGCGCGGG + Intronic
1061194950 9:129102537-129102559 CCCCCAGGTACTCCACGGGCAGG + Exonic
1061843931 9:133376262-133376284 ACCGCAGGGCCTGCGCGCGGCGG - Intergenic
1062331270 9:136045951-136045973 CCAGCAGGGACACCGGGAGCCGG - Intronic
1062536660 9:137024032-137024054 ACCTCAGGGACTCCGGGAGCAGG + Intronic
1185464203 X:345693-345715 CCCGCAGAGGCCCCGCGCTCAGG - Intronic
1185623708 X:1468556-1468578 CCCGCCGGGGCTCAGCGGGCAGG + Intronic
1187154701 X:16712284-16712306 CCCCCAGGGCCTCGGCGCCCGGG - Intronic
1198398802 X:136250830-136250852 CCCGCAGGGACTCCGCGCGCCGG - Intronic
1200068781 X:153517817-153517839 CCCGCAGCGACAGCGCCCGCCGG + Intronic
1200989928 Y:9337467-9337489 CCCTAAGGGACTGCGCGCGAAGG - Intronic
1200992597 Y:9357800-9357822 CCCTAAGGGACTGCGCGCGAAGG - Intronic
1200995250 Y:9378079-9378101 CCCTAAGGGACTGCGCGCGAAGG - Intronic
1200997914 Y:9398424-9398446 CCCTAAGGGACTGCGCGCGAAGG - Intronic
1201000423 Y:9466958-9466980 CCCTAAGGGACTGCGCGCGAAGG - Exonic
1201003085 Y:9487270-9487292 CCCTAAGGGACTGCGCGCGAAGG - Exonic
1201005744 Y:9507553-9507575 CCCTAAGGGACTGCGCGCGAAGG - Intergenic
1201008404 Y:9527883-9527905 CCCTAAGGGACTGCGCGCGAAGG - Intronic
1201048227 Y:9908160-9908182 CCCTAAGGGACTGCGCGCGAAGG + Intergenic