ID: 1198399681

View in Genome Browser
Species Human (GRCh38)
Location X:136256802-136256824
Sequence CCTCATCTGTAAAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198399681_1198399687 -6 Left 1198399681 X:136256802-136256824 CCATCCTCATTTTACAGATGAGG No data
Right 1198399687 X:136256819-136256841 ATGAGGAAGCAGGCCCAGGGAGG No data
1198399681_1198399685 -10 Left 1198399681 X:136256802-136256824 CCATCCTCATTTTACAGATGAGG No data
Right 1198399685 X:136256815-136256837 ACAGATGAGGAAGCAGGCCCAGG No data
1198399681_1198399690 15 Left 1198399681 X:136256802-136256824 CCATCCTCATTTTACAGATGAGG No data
Right 1198399690 X:136256840-136256862 GGTTAACTAACCTGCCCAGATGG No data
1198399681_1198399691 16 Left 1198399681 X:136256802-136256824 CCATCCTCATTTTACAGATGAGG No data
Right 1198399691 X:136256841-136256863 GTTAACTAACCTGCCCAGATGGG No data
1198399681_1198399686 -9 Left 1198399681 X:136256802-136256824 CCATCCTCATTTTACAGATGAGG No data
Right 1198399686 X:136256816-136256838 CAGATGAGGAAGCAGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198399681 Original CRISPR CCTCATCTGTAAAATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr