ID: 1198400139

View in Genome Browser
Species Human (GRCh38)
Location X:136260878-136260900
Sequence CAGGGTAAGACAGCACTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198400129_1198400139 23 Left 1198400129 X:136260832-136260854 CCATATGTCTCATTTATATCTTA No data
Right 1198400139 X:136260878-136260900 CAGGGTAAGACAGCACTTGGGGG No data
1198400128_1198400139 29 Left 1198400128 X:136260826-136260848 CCATCTCCATATGTCTCATTTAT No data
Right 1198400139 X:136260878-136260900 CAGGGTAAGACAGCACTTGGGGG No data
1198400135_1198400139 -8 Left 1198400135 X:136260863-136260885 CCTGCTGGGAAATAGCAGGGTAA No data
Right 1198400139 X:136260878-136260900 CAGGGTAAGACAGCACTTGGGGG No data
1198400132_1198400139 -2 Left 1198400132 X:136260857-136260879 CCACAGCCTGCTGGGAAATAGCA No data
Right 1198400139 X:136260878-136260900 CAGGGTAAGACAGCACTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198400139 Original CRISPR CAGGGTAAGACAGCACTTGG GGG Intergenic
No off target data available for this crispr