ID: 1198405061

View in Genome Browser
Species Human (GRCh38)
Location X:136304127-136304149
Sequence CTGTAGATATGGAGAGCAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198405058_1198405061 -7 Left 1198405058 X:136304111-136304133 CCAATTTCCTACTTCTCTGTAGA 0: 1
1: 0
2: 5
3: 26
4: 324
Right 1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG 0: 1
1: 0
2: 5
3: 30
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198405061 Original CRISPR CTGTAGATATGGAGAGCAGA TGG Exonic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903481864 1:23659479-23659501 TTGTAGATATGGGCAGGAGAGGG - Intergenic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
904767483 1:32861644-32861666 CTGTAGGTTTTGAAAGCAGAGGG - Intergenic
904957902 1:34302804-34302826 CTGAAATTATGGAGACCAGAAGG - Intergenic
905027657 1:34861993-34862015 CTGAATATGTGGAGAGGAGAAGG + Intergenic
905922144 1:41726931-41726953 CTGTACATATGGACTCCAGAGGG + Intronic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
912123035 1:106497020-106497042 CTTTTGATATGCATAGCAGATGG + Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914199579 1:145472936-145472958 CAGTTGCTATGGAGATCAGATGG + Intergenic
914478694 1:148046069-148046091 CAGTTGCTATGGAGATCAGATGG + Intergenic
916156662 1:161856493-161856515 CTTCAGATGTGGAAAGCAGAAGG - Intronic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
916827453 1:168456170-168456192 CTGAAGACATGGAGGGCAGGGGG + Intergenic
917136656 1:171794522-171794544 CTGAAGGTATGGAGAACAAAAGG + Exonic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
918178487 1:182065959-182065981 CACTAGAAATGGAGAGCGGAAGG + Intergenic
919479858 1:198074944-198074966 CTGTAGAGAAGGAGTGCTGATGG + Intergenic
919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923478579 1:234360571-234360593 CTGGAGTTATGTAGAGCAAATGG - Intergenic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
924133735 1:240940372-240940394 CTGTGGATCTGGAGACCAGGTGG - Intronic
1063731814 10:8706378-8706400 CTCTAGATTTTGAGAGCTGAGGG + Intergenic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1064833072 10:19493191-19493213 TTATAGAGATGGAGAGGAGAAGG - Intronic
1065567337 10:27026625-27026647 GTGTAGAAATGAAGATCAGAAGG - Intronic
1066495579 10:35938808-35938830 ATGTAGACATGCAGAACAGAGGG + Intergenic
1066646735 10:37618134-37618156 ATGTAGATATACAGAGCAGAGGG - Intergenic
1070104544 10:73418770-73418792 CAGTAGGTATGGAGAGCAAGAGG - Intergenic
1070640423 10:78164944-78164966 CTGTCCATATGGACAGCAGAAGG - Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075885881 10:125898606-125898628 CTGTAGCTAAGGAGAGGAGGAGG + Intronic
1075971362 10:126656646-126656668 CTATAGCTTTAGAGAGCAGACGG + Intronic
1076230758 10:128818150-128818172 CTGGAGATTTGGAGAGGAGATGG - Intergenic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1078597621 11:12702056-12702078 CTGTGTAAATGGAGAGCTGAAGG + Intronic
1078626655 11:12964227-12964249 TTCTCGATATGGACAGCAGAGGG + Intergenic
1082131459 11:48494869-48494891 CTGTGTATTTGAAGAGCAGATGG + Intergenic
1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG + Intronic
1089098845 11:115942914-115942936 CTGTTGTTTTGGAGAGCTGAAGG - Intergenic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1093518356 12:20018000-20018022 CTATATTTATGGAGAGCAAAAGG - Intergenic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1095575670 12:43735558-43735580 CTTAAAATATGGAGAGGAGAAGG - Intronic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1098693216 12:73516771-73516793 CAGAAGATATAGAGACCAGAAGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103587706 12:121968428-121968450 GTGTGGATATGTGGAGCAGAGGG - Intronic
1104830499 12:131747606-131747628 CTGTACACATGGAGGGCAGGAGG + Intronic
1106756193 13:32825351-32825373 CTGTAGATCTGGAAGGCTGATGG - Intergenic
1109035951 13:57260476-57260498 CAGTTGCTATGGAGATCAGATGG - Intergenic
1109611013 13:64764595-64764617 CTGCATGTATTGAGAGCAGAGGG - Intergenic
1110593222 13:77288300-77288322 CAGTAAATATTGAAAGCAGAAGG + Exonic
1110610759 13:77485273-77485295 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1117538915 14:56727714-56727736 CTGCAGATATGGAAATAAGAAGG + Intronic
1118106567 14:62666521-62666543 CTGCAGTCATAGAGAGCAGAAGG + Intergenic
1118334981 14:64845587-64845609 CTGTAGAGATGAAAAGCAAAAGG + Intronic
1118561521 14:67088936-67088958 ATGTAAATATGGAGAGCAATGGG - Intronic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1120255239 14:82110465-82110487 CTGTAGGTATTTAAAGCAGACGG + Intergenic
1120629312 14:86870578-86870600 CTGGAGACCAGGAGAGCAGATGG + Intergenic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1125228218 15:37420545-37420567 CTGTAGATCTGGCCATCAGAAGG - Intergenic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1129659634 15:77545844-77545866 CTGAAGAAATGGGGAGCAGGGGG + Intergenic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1129908558 15:79207232-79207254 CTGTAGACATTGAGGGGAGAGGG - Intergenic
1130792167 15:87167196-87167218 CTGTATATATGTAGAAGAGAAGG - Intergenic
1134670392 16:16050521-16050543 TTGTACATTTGTAGAGCAGAAGG + Intronic
1135533592 16:23275506-23275528 CTGTCTATCTAGAGAGCAGAAGG + Intergenic
1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG + Intergenic
1138433853 16:56986240-56986262 CAGGAGATATGGAGTCCAGAGGG + Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141102581 16:81208918-81208940 CAGTAGGTATGGAGTGCAGCTGG + Intergenic
1141848385 16:86626811-86626833 CTGCAGATGTGGGGAGAAGAGGG - Intergenic
1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143228316 17:5327570-5327592 CAGTATATATGGAGTGCATATGG + Intronic
1144371304 17:14594294-14594316 CAGGAGATATGGATAGAAGAGGG + Intergenic
1144447817 17:15347386-15347408 CTATAGATATGGAGGGCTGATGG + Intergenic
1144472606 17:15558183-15558205 CTGTTGGGATCGAGAGCAGAAGG - Intronic
1144923875 17:18786508-18786530 CTGTTGGGATCGAGAGCAGAAGG + Intronic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149380363 17:56087469-56087491 CAGTAGGTATCTAGAGCAGAAGG - Intergenic
1149549231 17:57527633-57527655 CTTCAGAAATGGGGAGCAGAAGG + Intronic
1149970544 17:61213911-61213933 CTATAGAAATGTAGTGCAGAGGG + Intronic
1150005965 17:61469179-61469201 CTCTAGAAAGTGAGAGCAGAGGG + Intronic
1150941251 17:69696943-69696965 CTCTGGATATTGAGAGCAGCAGG + Intergenic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1155505183 18:26526241-26526263 CTGGAGATTTGGGGAGCAGCAGG + Intronic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1157653310 18:49359638-49359660 CTGTTAATATTGAGAGCAAAGGG - Intronic
1158278085 18:55790599-55790621 CTATAGAAATAGAGAGCAGGAGG + Intergenic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1158763983 18:60425491-60425513 CTGGAAATATGGAGGACAGAAGG + Intergenic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1163054599 19:14708849-14708871 GTGAAGATATAGAGAGAAGATGG - Intronic
1163741826 19:19019021-19019043 CTGATGGTATTGAGAGCAGAGGG - Intronic
1164871279 19:31646134-31646156 ATGTAGAAACAGAGAGCAGAAGG - Intergenic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
1167867105 19:52337256-52337278 CTGATGACAAGGAGAGCAGAGGG + Intronic
1167958857 19:53090136-53090158 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167971758 19:53192313-53192335 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1168340683 19:55621588-55621610 CGCTAGTGATGGAGAGCAGAGGG - Exonic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
926404600 2:12538315-12538337 CTGAGGATATATAGAGCAGAAGG - Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
929768327 2:44869613-44869635 ATTTAGATAGGCAGAGCAGAGGG - Intergenic
930531539 2:52594856-52594878 CTGTAGATACAGGGATCAGATGG + Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930851086 2:55961290-55961312 CTGTAGATCTGGAAAGAAGTTGG + Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932347476 2:71005096-71005118 CTGTAGCTATGCATAGGAGAAGG - Intergenic
932891734 2:75602800-75602822 CTGTACAGCTGGAGAACAGAGGG + Intergenic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933656645 2:84894143-84894165 CAGTATACAGGGAGAGCAGAAGG + Intronic
935268584 2:101414740-101414762 CTGTCCATCTGGAGGGCAGAGGG - Intronic
937593831 2:123648662-123648684 CTATAGGTAGGAAGAGCAGATGG + Intergenic
940225230 2:151394002-151394024 TTGTAAATATCGTGAGCAGAAGG - Intergenic
940555434 2:155221099-155221121 CTATAGAGATAAAGAGCAGAAGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
940974365 2:159926860-159926882 CTGAAGCTATGGAGAGGAGCAGG + Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944080482 2:195782798-195782820 CAGAAGACATGGAGGGCAGATGG - Intronic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
946006572 2:216530260-216530282 ATGTATATATGGAGGGCACATGG - Intronic
946171327 2:217897730-217897752 ATGTAGAGGTGGTGAGCAGATGG + Intronic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
1169092166 20:2867589-2867611 GGCTAGATAGGGAGAGCAGAGGG - Intronic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169312973 20:4562979-4563001 CTGGAGATCAAGAGAGCAGAAGG - Intergenic
1170252919 20:14305461-14305483 CAGTATATATAGAGAGAAGAGGG + Intronic
1170282730 20:14669205-14669227 CTGTAACTCTGGAGAGGAGATGG - Intronic
1170757928 20:19221226-19221248 CTGCACATATTGAGAGGAGATGG - Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1172448021 20:35003192-35003214 ATGTAGCTAACGAGAGCAGAGGG + Exonic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174440381 20:50546939-50546961 CTGTCATTATGGAAAGCAGAAGG + Intronic
1175028692 20:55930677-55930699 TTTTAGACATGGAGACCAGAAGG - Intergenic
1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG + Intergenic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1178005556 21:28216159-28216181 TTTTAGATATTGAGAGCAGAAGG + Intergenic
1178142241 21:29697726-29697748 CTGAAGCTATGGGGAGGAGAAGG - Intronic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1180285904 22:10744137-10744159 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1182897248 22:33869027-33869049 ATGTAGACAGGGAGAGCAAAAGG + Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1184078306 22:42198631-42198653 CTGTATATATTCAGAACAGATGG + Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
951373215 3:21878958-21878980 ATGTACATTTGGAGAGCAGGAGG + Intronic
951527048 3:23663523-23663545 CTATAGATAAGGATAGCAAAGGG - Intergenic
953087808 3:39689189-39689211 TTATAGACATGGAGAGTAGAAGG + Intergenic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
955568754 3:60279515-60279537 CTTTAGATAGGTAAAGCAGAGGG + Intronic
956198302 3:66676397-66676419 CCGTAGATAAGGAGAGGATAGGG - Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
959169728 3:102830374-102830396 CAGTTGATATGGAGCCCAGAGGG + Intergenic
961061630 3:123833491-123833513 CTGAGGATAGGGAGAGCAGCAGG - Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961735205 3:128997086-128997108 CTGTACATCTGGTAAGCAGAGGG + Intronic
965768634 3:172157588-172157610 ATTTAGAGATGGAGAACAGATGG - Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966890111 3:184401096-184401118 CTGTAGACATTGTGAGAAGAAGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG + Intronic
970024645 4:11610537-11610559 CTGTACTTATGGAGCACAGAAGG + Intergenic
973698393 4:53513338-53513360 ATGAAGATATGGACAGTAGAAGG + Intronic
973984638 4:56338607-56338629 TTGTAGTTATGGAAAGCAAACGG + Exonic
975275144 4:72488965-72488987 TTATAGAAATGGAGAGTAGAAGG - Intronic
975421353 4:74167700-74167722 CTGAAGATCTGGAGAGAACATGG + Intronic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
975724844 4:77281883-77281905 CTGTAACTATGGAGACCAGGTGG + Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978015589 4:103741464-103741486 CTGTAGATATGAAAACCAGGGGG - Intergenic
979434009 4:120667666-120667688 CTGCACATATGGAGACCACAGGG - Intergenic
979627044 4:122856878-122856900 TTATAGAAATGGAGAACAGATGG - Intronic
982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG + Intergenic
984363547 4:178769548-178769570 CTGAATTTATGGAGACCAGAAGG - Intergenic
987206854 5:15636269-15636291 CTGTAGATGAGGAGAGTTGAGGG - Intronic
987756848 5:22107429-22107451 ATATATATATGAAGAGCAGAAGG - Intronic
988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG + Intergenic
989373599 5:40735649-40735671 TTGTTGATCTGGAGAGCAAAAGG + Intronic
991126303 5:63073425-63073447 CTTTAGATTAGGAGATCAGAAGG - Intergenic
991197484 5:63953396-63953418 CTGGAGACAAGGAGACCAGATGG - Intergenic
991734414 5:69618665-69618687 CTGCAGATAGGGGCAGCAGAGGG - Intergenic
991780564 5:70128060-70128082 CTGCAGATAGGGGCAGCAGAGGG + Intergenic
991810848 5:70473800-70473822 CTGCAGATAGGGGCAGCAGAGGG - Intergenic
991859852 5:71003483-71003505 CTGCAGATAGGGGCAGCAGAGGG + Intronic
991873012 5:71128379-71128401 CTGCAGATAGGGGCAGCAGAGGG + Intergenic
992056124 5:72992591-72992613 CTATAGATAGGGAGAAAAGAAGG + Intronic
992488523 5:77218537-77218559 CTGCAGTTATTTAGAGCAGAAGG + Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
995053976 5:107738603-107738625 CTGTAGATATGCAGAAGACATGG + Intergenic
998524446 5:142829516-142829538 CTAGAGATCTGCAGAGCAGAGGG + Intronic
998808057 5:145938020-145938042 CTGTAGACATGGTTTGCAGAAGG - Exonic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
1000158479 5:158575546-158575568 CTGAAGCTTTGGAGAGCTGATGG + Intergenic
1000195709 5:158955452-158955474 TTGTTGATATGAAAAGCAGAAGG - Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1004406538 6:15338476-15338498 CTGTAGACATTGAGGACAGATGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1008342758 6:50387682-50387704 CTGTAGACATGGTGAGAGGAGGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1014203686 6:118631755-118631777 CTATAGAAATGGAGAGTAAATGG + Intronic
1015388310 6:132651450-132651472 CTAGATATATAGAGAGCAGAAGG - Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016542039 6:145177540-145177562 TTATGGATATAGAGAGCAGAAGG + Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1017027207 6:150191918-150191940 GTGTAGATAGGGAAAGAAGAGGG + Intronic
1017776317 6:157683782-157683804 CTGGAGATAATGAGAACAGATGG + Intergenic
1018133288 6:160752811-160752833 ATGTATATATGGATAGTAGAAGG + Intronic
1018674293 6:166205738-166205760 CTTTAGATATGAAGACCAAAAGG + Intergenic
1019926464 7:4196337-4196359 CTGTAGCTAGGGAGTGCACAGGG - Intronic
1020490048 7:8770819-8770841 ATGTAGAATTGGAAAGCAGAAGG + Intergenic
1021405303 7:20260991-20261013 CAGAAGATATGTAGAGCAGGGGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1025233469 7:57218319-57218341 CTGGAGACCTGGATAGCAGATGG + Intergenic
1026466669 7:70660436-70660458 GCGTAGATTTGGAGAGAAGAAGG + Intronic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1033271971 7:139940153-139940175 CTTTGCATATGAAGAGCAGAGGG + Intronic
1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG + Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1037620148 8:20556294-20556316 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1037620160 8:20556363-20556385 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1037686279 8:21142188-21142210 CTGTCTATTTGGAGAGCAGGTGG - Intergenic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1038556337 8:28520813-28520835 CTGAAGATATGGAATGCAGTAGG + Exonic
1040937226 8:52794424-52794446 ATGAAGAAATGGAGACCAGAAGG + Intergenic
1041501344 8:58542215-58542237 GTGAAAATATGGAGAGCTGATGG + Intergenic
1041945264 8:63433698-63433720 CAGGGAATATGGAGAGCAGAGGG + Intergenic
1043339011 8:79214773-79214795 CTATATACATGGAGAGAAGATGG - Intergenic
1044054539 8:87552393-87552415 CTGTAGATAAGTAGAACAAAGGG + Intronic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1048150521 8:131889134-131889156 CAGTAGATAAGTAAAGCAGATGG + Intergenic
1048462239 8:134630688-134630710 CTGTAGTTATGTAGAACAGCTGG - Intronic
1048856915 8:138693945-138693967 CTGTAGAAATGTAGCTCAGAGGG + Intronic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049672230 8:143875056-143875078 CTGCAGATTTGGGGAGCTGAGGG - Intronic
1050254143 9:3776637-3776659 CTGGAGATATGGTGAGATGAAGG - Intergenic
1051874685 9:21778996-21779018 CTGTAGAAGCTGAGAGCAGAAGG - Intergenic
1051944227 9:22547064-22547086 GTGAAGATGTGGAGAGGAGATGG - Intergenic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1052227090 9:26103050-26103072 ATATAGATATGGAGGGCAGGAGG + Intronic
1052351220 9:27460307-27460329 CAGAAAATATGGAGAGCACATGG - Intronic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1053052684 9:34975028-34975050 CTGGAGGTGTGGAGAGCAGTTGG - Intronic
1053200245 9:36147320-36147342 CTGGACCTAGGGAGAGCAGAGGG - Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053859577 9:42373388-42373410 CTGCAGATATTGAAAACAGAAGG + Intergenic
1054251613 9:62722806-62722828 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054565724 9:66757323-66757345 CTGCAGATATTGAAAACAGAAGG - Intergenic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG + Intronic
1059468255 9:114483382-114483404 TTGTAGAAATGGAGACAAGAAGG - Intronic
1060251634 9:121990942-121990964 CTGCAGCTATGGAGAGCGGATGG + Intronic
1060299695 9:122368069-122368091 CTGTAGCTAGGGTGAGCAGGAGG + Intergenic
1061644250 9:131987336-131987358 CTGTAGATGTGGAGATGAGAAGG + Intronic
1062304440 9:135895392-135895414 CTGAAGCTATGGAGGCCAGAGGG + Intronic
1203732255 Un_GL000216v2:101191-101213 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1185936159 X:4258662-4258684 ATGTAGAGAAGGAGAGCTGATGG - Intergenic
1185996949 X:4962318-4962340 CTGTTTATATTGAGAGCAAAAGG - Intergenic
1186136079 X:6522545-6522567 CTCTAAATATGGAAATCAGAAGG - Intergenic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187985272 X:24803279-24803301 CTGGAGAGAAGGAGAGCACACGG + Intronic
1188248598 X:27863886-27863908 CTTTAGATATGGAGAGTACTTGG + Intergenic
1191800975 X:65079051-65079073 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1192722328 X:73712114-73712136 CCGAAGAGATGGAGAGCATAAGG + Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195848701 X:109258149-109258171 TTGTAGACATAAAGAGCAGAAGG - Intergenic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199158203 X:144574586-144574608 CTGTAGATAAGCAGAAGAGAAGG - Intergenic
1199687546 X:150277828-150277850 TTGTAAAACTGGAGAGCAGAAGG + Intergenic
1199851798 X:151729153-151729175 CTGAAGATATGGAGCTCAGGAGG + Intergenic
1200176756 X:154122410-154122432 CTCTAGTTATTCAGAGCAGAAGG - Intergenic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic
1202628683 Y:56886367-56886389 CTGTAGCTAAGGAGAGGAGGAGG - Intergenic