ID: 1198405102

View in Genome Browser
Species Human (GRCh38)
Location X:136304569-136304591
Sequence CTGTGCTAACTCCTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198405097_1198405102 -5 Left 1198405097 X:136304551-136304573 CCTACTATGTGTCAGGCACTGTG 0: 11
1: 187
2: 794
3: 2558
4: 6139
Right 1198405102 X:136304569-136304591 CTGTGCTAACTCCTGGGGCAGGG 0: 1
1: 1
2: 1
3: 19
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198405102 Original CRISPR CTGTGCTAACTCCTGGGGCA GGG Intronic
900494326 1:2969591-2969613 CCAGGCTGACTCCTGGGGCAGGG + Intergenic
900619790 1:3581462-3581484 CTGTGCTTCCTCCAGGGTCATGG - Intronic
900692019 1:3986783-3986805 CTGTGGATGCTCCTGGGGCATGG + Intergenic
901240423 1:7689828-7689850 GTGTCCTAGCTTCTGGGGCATGG - Intronic
901652659 1:10752081-10752103 CCGTGCTAGCTCCTTGGGGAGGG - Intronic
901821764 1:11834910-11834932 CTATTCTCACTCCTGGGGCTTGG - Intronic
902107497 1:14049966-14049988 CTTAGCTAACTCCTCAGGCAAGG - Intergenic
902839497 1:19066155-19066177 CTGTGCTGAGTCCTGGGGAGGGG - Intergenic
903016554 1:20365787-20365809 CAGTGCTAATGCATGGGGCATGG + Intergenic
903060244 1:20664117-20664139 CTGTGCCACCCCATGGGGCAGGG + Exonic
903535327 1:24062979-24063001 CTCTGCTAACCCCTGGGACCAGG + Intronic
906218127 1:44056339-44056361 ATGTGCTCACTCCTGGAACAAGG + Intergenic
906683212 1:47744957-47744979 CTGTGCTAGATCCTGGGGTAGGG - Intergenic
907316314 1:53574918-53574940 GTGTGATCACTCCGGGGGCAGGG + Intronic
907489326 1:54799158-54799180 CTGTGCTGTGTCCTGGGGCATGG - Intronic
907927225 1:58966109-58966131 TGGTGGTAACTCCCGGGGCAGGG + Intergenic
912659044 1:111512552-111512574 CTGTGCTAACTGCTGTGCCTGGG - Intronic
914807496 1:151002312-151002334 CTGAGGAAGCTCCTGGGGCATGG + Exonic
915328100 1:155091741-155091763 CTGTTCTCAGGCCTGGGGCAGGG + Intergenic
915616492 1:157043480-157043502 CTGGGCAGACTCTTGGGGCAAGG + Intronic
916039789 1:160952068-160952090 CTGTGCTGTCTTGTGGGGCAAGG + Intronic
917834765 1:178932653-178932675 CTGTGCTAGGTTCTGGGGAAGGG + Intergenic
917963394 1:180163934-180163956 CTGTACTAGCTCATGGGACACGG + Intronic
919980825 1:202642247-202642269 CAGTGCTCACTTCCGGGGCAGGG - Intronic
920294100 1:204945434-204945456 CTGTGGTAACTCCAGGACCAGGG - Intronic
923092787 1:230752643-230752665 CTGTGCTAGCTCCTGGGGCAGGG - Intronic
924638777 1:245813390-245813412 CTGTGCTTGCACCTGGGGGAAGG - Intronic
1067536206 10:47112095-47112117 CTGTGCTACCTGCTGCGGCATGG + Intergenic
1070365585 10:75733704-75733726 CTCTGCTAACTCCTGAGGAGAGG - Intronic
1070984994 10:80681004-80681026 CTGTGCTGCCCACTGGGGCAGGG + Intergenic
1072301795 10:94068957-94068979 CTGTGCTAAGCACAGGGGCAGGG - Intronic
1072888576 10:99301440-99301462 ATGTGCTTACTCCTGGGACAAGG + Intergenic
1072888995 10:99304723-99304745 ATGTGCTCACTCCTGGGACAAGG + Intergenic
1075821908 10:125321779-125321801 CTGTCCTAAGTGCTGGGGTATGG - Intergenic
1076671014 10:132121146-132121168 CTCTGCTGACACTTGGGGCAGGG - Intronic
1076863054 10:133151035-133151057 CTGTGATAACTCCAGGGTTATGG - Intergenic
1076888178 10:133272021-133272043 CTGTGCCAAGTCCTGGGCCCTGG - Intronic
1077932782 11:6751623-6751645 ATGTGCTCACTCCTGGGACAAGG - Intergenic
1078571043 11:12458274-12458296 CTGAGAAAACTCCTGGGGCCAGG - Intronic
1082013829 11:47469630-47469652 CTGTGCTAACTCACTGGGCAGGG + Intronic
1082704288 11:56474404-56474426 CTGTTATAAATACTGGGGCAGGG - Intergenic
1084020380 11:66413765-66413787 CGGTGCCAACTCCTCAGGCAGGG + Intergenic
1084598896 11:70133295-70133317 CTCTGCTTACTGATGGGGCACGG - Intronic
1084654719 11:70508364-70508386 CAGGGCTAAGTCCTGGGGCGGGG + Intronic
1086228622 11:84542099-84542121 CTGTGCCAACTCCTGCTACAAGG - Intronic
1088683539 11:112265777-112265799 CTGTGTTAACTCGAGGGACAAGG + Intronic
1089498936 11:118921836-118921858 CTGTGCTAGCTGGTGGGGAAGGG - Intronic
1090793092 11:130109273-130109295 CTGTTCTAGCTCCTGGGAAAAGG + Intronic
1090895168 11:130965340-130965362 CTGTGCTCACACCTGGGTGATGG - Intergenic
1096941600 12:55352394-55352416 CTGTGCCAACTCCTGGGGGAGGG + Intergenic
1096944768 12:55392345-55392367 GTGTGCTCACGCTTGGGGCACGG - Intergenic
1097039946 12:56149982-56150004 CTGTGGTAAGTCCTGGGGTCAGG + Intergenic
1098930155 12:76402322-76402344 GATTGCTAACTCCTGGGTCATGG - Intronic
1099543886 12:83951310-83951332 CTGTGATAGCATCTGGGGCAGGG - Intergenic
1100511765 12:95281853-95281875 CTTAGCTAATTCCTAGGGCAAGG + Intronic
1102350835 12:112190904-112190926 CAGTGGGAACTCCAGGGGCAGGG + Exonic
1104299387 12:127550483-127550505 CTGTGGGAACACCTAGGGCAGGG + Intergenic
1104847389 12:131853286-131853308 CCGTGCTGGGTCCTGGGGCAGGG + Intergenic
1107073264 13:36294790-36294812 CTGTTCTAATTACTGGTGCATGG - Intronic
1107409779 13:40147911-40147933 CTGTGCTGATTCCAGGGCCATGG + Intergenic
1113194894 13:107791398-107791420 TAGTGATTACTCCTGGGGCATGG + Intronic
1114411059 14:22500893-22500915 CTGTGTTATGTCCTGGGGAAGGG + Intergenic
1116069821 14:40029731-40029753 CTGTGATAATGCCTGGGACATGG - Intergenic
1118177567 14:63456883-63456905 CTGTGTTAATTCTTGGTGCATGG - Intronic
1118346882 14:64947394-64947416 CTGTGGGTACTCCAGGGGCAAGG - Exonic
1119068203 14:71552111-71552133 CTGTCCTAAAGCCTGGGGAAAGG - Intronic
1119148011 14:72333795-72333817 TTGTGCTAGCTCCTCTGGCAGGG - Intronic
1119621073 14:76132287-76132309 CTGTGCTAAGTGCTGTGCCAAGG + Intergenic
1119702629 14:76765591-76765613 CTGTGCCAGCTCCAGTGGCATGG - Intronic
1121657190 14:95605624-95605646 CTTAGATAACTCCTGGGGTAGGG + Intergenic
1121781477 14:96624971-96624993 CTGTGCGAGCACCAGGGGCAGGG - Intergenic
1123468245 15:20531584-20531606 CTGTGCTTCCTCCTGGGAGAGGG - Intergenic
1123649871 15:22469480-22469502 CTGTGCTTCCTCCTGGGAGAGGG + Intergenic
1123728562 15:23126794-23126816 CTGTGCTTCCTCCTGGGAGAGGG - Intergenic
1123740272 15:23278299-23278321 CTGTGCTTCCTCCTGGGAGAGGG + Intergenic
1123746726 15:23324259-23324281 CTGTGCTTCCTCCTGGGAGAGGG - Intergenic
1124278993 15:28347575-28347597 CTGTGCTTCCTCCTGGGAGAGGG - Intergenic
1124496524 15:30190991-30191013 CAGTGCTCACTTCCGGGGCAGGG - Intergenic
1124532603 15:30520510-30520532 CTGTGCTTCCTCCTGGGAGAGGG + Intergenic
1124747051 15:32347657-32347679 CAGTGCTCACTTCCGGGGCAGGG + Intergenic
1124766050 15:32487134-32487156 CTGTGCTTCCTCCTGGGAGAGGG - Intergenic
1125322478 15:38502899-38502921 CTGTGCTAATTGCTGAGGAAGGG - Intronic
1125972828 15:43926025-43926047 CTGTGCTAAGTTCTGGGGGAAGG - Intronic
1127389398 15:58492989-58493011 CTCTGCTAAATCCTGGCGCCAGG + Intronic
1127632768 15:60841952-60841974 CTGTTCTCTCTCCTGGGGGAAGG - Intronic
1128721356 15:69952252-69952274 CTGTTCTAACCCCCGGGGAAAGG + Intergenic
1128881750 15:71250229-71250251 CTCTGCTATCTGCTGAGGCAGGG - Intronic
1131763918 15:95654715-95654737 TTCTGCCAACTCCTGGGGAAAGG + Intergenic
1132176823 15:99722414-99722436 TTGTGCTTTGTCCTGGGGCATGG - Intronic
1132626368 16:893579-893601 CTGTGAGGACTCCTGGGGCACGG + Intronic
1133120268 16:3602234-3602256 CCGTGCAAACTCCTGCTGCAGGG + Exonic
1133246879 16:4455014-4455036 CTGTTCCAACTCCTGGGGGTGGG - Intronic
1134199729 16:12187952-12187974 CCTAGCTAACTCCTAGGGCATGG - Intronic
1134885007 16:17782992-17783014 CTGTGCTACATACTGGGGAAAGG - Intergenic
1135876078 16:26201231-26201253 CTGTGCTGGGTCCTGGGGAATGG - Intergenic
1136268117 16:29132540-29132562 CTGTGCCTTCTGCTGGGGCAGGG + Intergenic
1138146012 16:54612454-54612476 AGGAGCTAACTCATGGGGCAGGG + Intergenic
1138152406 16:54670706-54670728 CAGTGCAAAGTCCTGAGGCAGGG - Intergenic
1138451531 16:57096007-57096029 CTGTTCTAAGTGCTGGGACATGG - Intronic
1139972741 16:70786284-70786306 CAGGGCAAACTCCTGGGACAGGG + Exonic
1142071427 16:88092878-88092900 CTGTGCCTTCTGCTGGGGCAGGG + Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142979579 17:3663885-3663907 CTGTGTTCTCTCCTGGGGCCAGG - Exonic
1147686617 17:42289814-42289836 CTGTGGCACCTCCTTGGGCAAGG - Intronic
1148283749 17:46370054-46370076 CTGTATTCACTCCTGGGCCAGGG + Intergenic
1148305967 17:46587971-46587993 CTGTATTCACTCCTGGGCCAGGG + Intergenic
1150844414 17:68640794-68640816 CTATGCTAAGTGGTGGGGCATGG - Intergenic
1152154048 17:78621542-78621564 CTCTGCCGACTCCTGGGACACGG - Intergenic
1155838050 18:30612333-30612355 CTATGCTACCTCCTGTGCCATGG + Intergenic
1156812106 18:41265041-41265063 CTGTGTTAAATACTGGGACAAGG + Intergenic
1156847337 18:41681808-41681830 ATGTGCTAACTGCTGTGGTAGGG - Intergenic
1157669625 18:49517376-49517398 CTTTGCTACCTGCTGGGGAAAGG - Intergenic
1160947546 19:1650745-1650767 CTGTGCCATCTGCTGGGGGAGGG - Intronic
1161134196 19:2610089-2610111 CTGAGCTGTCCCCTGGGGCAAGG - Intronic
1161379987 19:3959817-3959839 CGGGGCTGACTCCTGGGGCCAGG - Intronic
1161441523 19:4294483-4294505 CTGTGCTCCCGCCTGGGGGAAGG - Intronic
1165215835 19:34271796-34271818 CTGTGCTCTAGCCTGGGGCATGG + Intronic
1165351701 19:35279307-35279329 CTGTGCTAAGGGCTGGGGAAGGG - Exonic
1165487440 19:36104139-36104161 TTGTGCTAAACCCTGGGACATGG + Intronic
1165752148 19:38266720-38266742 CTGTGGTAACTTCTGGGGACTGG + Intronic
1166976642 19:46608744-46608766 CTGTGCTCACTGCTGAGGGATGG + Intronic
1168486080 19:56763182-56763204 CTCTGGTGACTACTGGGGCATGG + Intergenic
925620807 2:5790972-5790994 CTGTGCTAATTGCAGGGCCATGG + Intergenic
927177928 2:20423238-20423260 CTGAGCTAAGGCCTGGAGCAGGG - Intergenic
929646852 2:43637129-43637151 CAGAGCTCCCTCCTGGGGCAGGG + Intergenic
931227175 2:60341554-60341576 CTGTGGTAACTCCTTGAGCTAGG - Intergenic
931359372 2:61565127-61565149 TTGTCCCAGCTCCTGGGGCAGGG - Intergenic
931365591 2:61615971-61615993 GGGCCCTAACTCCTGGGGCAGGG + Intergenic
932698317 2:73975637-73975659 CTGTGGGCACTCCTGGGGCAAGG - Intergenic
936857704 2:116980182-116980204 CTGAGCTCACTCTTTGGGCAGGG - Intergenic
937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG + Intergenic
939059331 2:137400837-137400859 CTGTGCTGTGTCCTGGAGCAGGG + Intronic
945447886 2:209959724-209959746 CTGTGTTCACACTTGGGGCAGGG - Intronic
946009803 2:216555388-216555410 CTGTGCCAACTTCTGGGCCCAGG + Intronic
948032717 2:234832565-234832587 CTGTGCTAAATACTGGCACATGG + Intergenic
1169680976 20:8213470-8213492 CTCTGCTACCTCCTGCTGCAGGG - Intronic
1170080985 20:12475445-12475467 CAGTGCTAACTCCTTGGTCTTGG + Intergenic
1171009995 20:21504374-21504396 CTGTTCTCACTCCTGGGCCTGGG - Intergenic
1171291263 20:23984338-23984360 CAGTTCCAACACCTGGGGCAGGG - Intergenic
1171293171 20:23994167-23994189 CTATGCTAAGCCCTGGGACATGG - Intergenic
1172387108 20:34541720-34541742 CAGTGGTGACTTCTGGGGCAGGG - Intergenic
1172698937 20:36840897-36840919 CTGTGCTAAGCGCAGGGGCAGGG + Intronic
1172950036 20:38717295-38717317 CTGAGGCAACTCCTGGGACAGGG - Intergenic
1173019967 20:39258862-39258884 AAGTGCCAACTCCTGGGCCAGGG - Intergenic
1173250611 20:41362465-41362487 CTGTGACAGCTCCTGGCGCAGGG + Exonic
1173648076 20:44646069-44646091 CTGTGGTACCCCCTGGGGCGGGG - Intronic
1175191099 20:57212716-57212738 CTGGGCTGACTCCAGGTGCACGG - Intronic
1176200828 20:63859552-63859574 GTGTGTTTCCTCCTGGGGCAGGG + Intergenic
1179489881 21:41734358-41734380 CTGTCCTTTCTCCTGGAGCAAGG + Intergenic
1180057207 21:45365140-45365162 CTGGCCCAACTCCAGGGGCAGGG - Intergenic
1180824228 22:18851881-18851903 CTATGCTAAGCCCTGGGACATGG - Intronic
1181047783 22:20223773-20223795 CTGTGCTGGCTCCTGGGACGTGG + Intergenic
1181124656 22:20695035-20695057 CTATGCTAAGCCCTGGGACATGG - Intergenic
1181188508 22:21122667-21122689 CTATGCTAAGCCCTGGGACATGG + Intergenic
1181210692 22:21287826-21287848 CTATGCTAAGCCCTGGGACATGG - Intergenic
1181287331 22:21763253-21763275 CTCTGCTAAATCCTCAGGCATGG + Exonic
1181400697 22:22648597-22648619 CAGTTCCAACACCTGGGGCAGGG + Intergenic
1181501549 22:23318418-23318440 CTATGCTAAGCCCTGGGACATGG + Intergenic
1181650604 22:24256997-24257019 CTATGCTAAGCCCTGGGACATGG - Intergenic
1181702677 22:24629695-24629717 CAGTTCCAACACCTGGGGCAGGG + Intergenic
1181706777 22:24653741-24653763 CTATGCTAAGCCCTGGGACATGG + Intergenic
1182527256 22:30928126-30928148 CCGTGCTGACTCCCGGGCCAAGG - Exonic
1183120562 22:35727139-35727161 CTGTTCCAGCTCCCGGGGCAGGG + Exonic
1183144539 22:35977839-35977861 CTGTGCTAACTCCTCTGTGACGG - Intronic
1183655954 22:39184839-39184861 CTGTGCCCACTCCTGCAGCAAGG + Intergenic
1184231950 22:43163098-43163120 CTCTGCTGACCCCTGGGCCAAGG - Exonic
1184445689 22:44545540-44545562 CTGTGCTCACTCTGGGTGCAGGG + Intergenic
1203216255 22_KI270731v1_random:7604-7626 CTATGCTAAGCCCTGGGACATGG + Intergenic
950713673 3:14832288-14832310 CTGTGACAACACCTGGTGCAGGG - Intronic
950977899 3:17269323-17269345 CTGTGCTAACTCCTCTGAGAGGG + Intronic
950978001 3:17270419-17270441 CTGTGCTAACTCCTGTGAGAGGG - Intronic
951235134 3:20226212-20226234 TTAAACTAACTCCTGGGGCAGGG - Intergenic
952742053 3:36743505-36743527 CTGTGTTACTTCCTGGGACATGG - Intergenic
952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG + Intergenic
954197050 3:49003096-49003118 CTGTGCTAACTGCTGGGGAGGGG + Intronic
954409389 3:50363815-50363837 CAGTGCCAAATGCTGGGGCAGGG - Intronic
954701158 3:52451582-52451604 CTGCTCTGCCTCCTGGGGCATGG - Intronic
955489549 3:59468717-59468739 CTTTGTTAACTCCTGGGCCTAGG - Intergenic
958943425 3:100338206-100338228 CTGTGCTCAGCCCTGGAGCAAGG - Intronic
960000115 3:112722644-112722666 CATTGTTACCTCCTGGGGCAAGG + Intergenic
960038643 3:113127133-113127155 CTGTGTCAGCACCTGGGGCATGG - Intergenic
960148669 3:114230436-114230458 CAGTCCTGACTCCTGGGGCTGGG - Intergenic
961025266 3:123550192-123550214 CATTGCTAAAGCCTGGGGCATGG - Intronic
961589419 3:127965012-127965034 CTGTGCCCACTCATGCGGCAGGG + Intronic
961815468 3:129547936-129547958 CTGTGCTAACTTCTGGGTCCTGG + Intronic
962140945 3:132790195-132790217 CTGTCCTGACTCCTGAGTCAAGG - Intergenic
967881836 3:194306993-194307015 CCTTGCCAGCTCCTGGGGCAGGG - Intergenic
968396533 4:243630-243652 CTGTGCTGCCTGCTGTGGCAGGG - Intergenic
968518852 4:1026702-1026724 CTGTGGTCTCTCCTGGGGCCCGG + Exonic
968652765 4:1766739-1766761 CTGTGCTGACCCCTGAGGCGGGG - Intergenic
968952636 4:3702716-3702738 CAGTGCTGACTCCAGGGGCAGGG + Intergenic
969058679 4:4417972-4417994 CTGTGCTGACTCCTGAGTCGGGG + Exonic
970144104 4:13014651-13014673 CTGAGCTCAGTCCTGGGGCTGGG - Intergenic
970593574 4:17579559-17579581 CTGTGCTCACTCCTAGGAGACGG - Intronic
970993502 4:22239007-22239029 CTGTGTTGACTACTGTGGCAGGG + Intergenic
974556203 4:63451877-63451899 CTGTGCTCTCTCTTGGGGAAGGG + Intergenic
975497286 4:75048590-75048612 CTGCCGTAAATCCTGGGGCAAGG + Exonic
978249134 4:106610053-106610075 CTGGGCTAGCATCTGGGGCAGGG - Intergenic
980881952 4:138719592-138719614 CAGACCTAAGTCCTGGGGCAAGG - Intergenic
984920291 4:184758057-184758079 CTGAGTGAACTCCTGGGGGAGGG - Intronic
986150242 5:5121581-5121603 CTGTGCTGACTGCTGAGGGAAGG + Intergenic
987041683 5:14068807-14068829 ATGTGCTAACTTGTGTGGCAGGG - Intergenic
990625461 5:57605469-57605491 CTGTACTGACTCTTGGTGCAAGG - Intergenic
992689501 5:79229039-79229061 CTGGACTCACTCCTGGGCCAGGG - Intronic
992851379 5:80812928-80812950 CTGGGCTAACTCCTCTGCCAAGG + Intronic
994927685 5:106139549-106139571 TTGTTCTAATTCCTAGGGCAGGG + Intergenic
998940788 5:147280281-147280303 GTGTGCAGACTCCGGGGGCAGGG + Intronic
1001136058 5:169103749-169103771 GTGTGCTCACTCCTCGGGCCAGG + Intronic
1001685801 5:173594025-173594047 CTCTGCTGGCTCCTGTGGCAAGG + Intergenic
1003635613 6:7828941-7828963 CTGTGCCAAGCCCTGGGACACGG - Intronic
1005486008 6:26300117-26300139 CTGTGCTAGCCACTGGGGCCTGG - Intergenic
1005812841 6:29529850-29529872 CTGTTCTACCTCTTGGGGAAGGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007176583 6:39901720-39901742 CTGGGCTAACTCCTAGGCCATGG - Intronic
1011880061 6:92013107-92013129 CAGTGACAACTACTGGGGCAAGG + Intergenic
1012977132 6:105792807-105792829 ATGTGTTAACTGGTGGGGCAAGG - Intergenic
1019082230 6:169442675-169442697 ATGTGCCCACTCCTGGGCCAGGG - Intergenic
1023325015 7:39044927-39044949 CTGTGGTCATTCCAGGGGCATGG + Intronic
1024976266 7:55116659-55116681 CCGTGCTGCCTCCTGGGACAGGG + Intronic
1026681866 7:72473009-72473031 CTGTACCATCTCCTGGGCCAGGG + Intergenic
1026972739 7:74477962-74477984 CGGTGCCAACCCCTGGGGCCAGG - Intronic
1027826089 7:83118493-83118515 CTATGCTCACTGCTGGGGGATGG - Intronic
1027991504 7:85368964-85368986 CTCCGGTAACTCCTGGGGAAGGG - Intergenic
1029202869 7:98850800-98850822 CAGTGGCAACTGCTGGGGCAGGG + Intronic
1029311288 7:99667385-99667407 CTCTGCACACTCCTGGGGAAGGG - Intronic
1031172565 7:118309765-118309787 CTTTGCTAATTCCTGGGTAATGG + Intergenic
1032957420 7:136987201-136987223 CTGTGCTATGTGCTGGAGCAGGG - Intronic
1034061627 7:148097019-148097041 CTGTGCCCATTCCTGGAGCATGG - Intronic
1035642733 8:1196360-1196382 CTGTGCTGACACCTGGGGATGGG - Intergenic
1036511155 8:9401636-9401658 CTGTGCTATCTCCTGTTGCGTGG - Intergenic
1036606075 8:10306867-10306889 CTGTCCTCAGTCCTGGAGCAAGG + Intronic
1037893080 8:22634327-22634349 CAGTGCTAATTCCTGGGCCGTGG - Intronic
1039984932 8:42439132-42439154 ATTCGATAACTCCTGGGGCATGG + Intronic
1041424349 8:57703469-57703491 CTGTGCCAAGTCCTTGGCCAAGG + Intergenic
1042189956 8:66176932-66176954 CTGTGCTAACTGCTCGGCCCTGG + Exonic
1043379962 8:79691966-79691988 CTGTGCTCATTCCTGGGCCTAGG - Intergenic
1045036045 8:98177169-98177191 CAGTGCCAAGTGCTGGGGCAGGG - Intergenic
1048083572 8:131154238-131154260 CTGTGCTTTCTCCTGTGCCAGGG + Intergenic
1048565094 8:135588059-135588081 CTGTGCTAACTCCTGGTAAATGG - Intronic
1049218660 8:141418951-141418973 CTTTGCTCTCACCTGGGGCAGGG + Intronic
1049337028 8:142092082-142092104 ATTTGCTAATTCCTGGGGCATGG - Intergenic
1049595665 8:143482196-143482218 CTGTGCTCCCTCCTGGCGCCAGG + Intronic
1050870173 9:10557741-10557763 CTGGGATAACTCCTCGGGAAGGG + Intronic
1050992475 9:12171334-12171356 ATGTGCTCACCCCTGGGACAAGG - Intergenic
1051667790 9:19481629-19481651 CAGTCCAGACTCCTGGGGCAGGG - Intergenic
1053071399 9:35104254-35104276 CAGTCCTAACTCCTGGGGCTGGG - Exonic
1053090348 9:35269627-35269649 ATGTGATAACTCCTGGAGGATGG - Intronic
1056277656 9:85008807-85008829 CTGTGTCAAATCCTGCGGCAAGG + Intronic
1056761612 9:89419364-89419386 CTGTTGAAACTCCTGGGGCAGGG + Intronic
1057466732 9:95321014-95321036 CTGGGCTAACTCCTTGGCCTGGG + Intergenic
1060068170 9:120523034-120523056 ATCTGCTACCTCCTCGGGCAAGG + Intronic
1060223189 9:121775037-121775059 CTCTGCCATCTGCTGGGGCAAGG + Intronic
1061653764 9:132071661-132071683 GTGTGCTCATTCATGGGGCACGG - Intronic
1062278043 9:135739820-135739842 CTGTGCACGCTCCTGGGTCAAGG - Intronic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1189929001 X:45988052-45988074 CTTTGCTACCTACTGGGGAATGG - Intergenic
1191746538 X:64495391-64495413 GTGTGCTTACTCCAGTGGCAGGG - Intergenic
1192551158 X:72054855-72054877 TTGTGCTAACTGCAGGGGGAGGG - Intergenic
1194024652 X:88736421-88736443 CTGTGCAGAATCCTGGTGCAGGG - Intergenic
1196296145 X:113999517-113999539 CAGTGCTAACACCTGGGGTGAGG - Intergenic
1196669747 X:118352861-118352883 CAGTGCTGCTTCCTGGGGCATGG + Intronic
1196691704 X:118565790-118565812 CTGTGCTCAGTCCTGAGGGAGGG + Intronic
1196776876 X:119346250-119346272 CTGTGCTAACTGCTGCTGTAAGG + Intergenic
1197900545 X:131367234-131367256 CTCTACTAATTCCTAGGGCAGGG - Intronic
1198405102 X:136304569-136304591 CTGTGCTAACTCCTGGGGCAGGG + Intronic
1201392300 Y:13512322-13512344 CTCTGCTAACTCGTAGGGGATGG - Intergenic