ID: 1198417189

View in Genome Browser
Species Human (GRCh38)
Location X:136432612-136432634
Sequence CTGGAGACTCAGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198417189_1198417196 7 Left 1198417189 X:136432612-136432634 CCTTCCCCCTTCTGAGTCTCCAG No data
Right 1198417196 X:136432642-136432664 TATACCATTCTGTATGCCTTTGG No data
1198417189_1198417197 8 Left 1198417189 X:136432612-136432634 CCTTCCCCCTTCTGAGTCTCCAG No data
Right 1198417197 X:136432643-136432665 ATACCATTCTGTATGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198417189 Original CRISPR CTGGAGACTCAGAAGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr