ID: 1198417197

View in Genome Browser
Species Human (GRCh38)
Location X:136432643-136432665
Sequence ATACCATTCTGTATGCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198417189_1198417197 8 Left 1198417189 X:136432612-136432634 CCTTCCCCCTTCTGAGTCTCCAG No data
Right 1198417197 X:136432643-136432665 ATACCATTCTGTATGCCTTTGGG No data
1198417190_1198417197 4 Left 1198417190 X:136432616-136432638 CCCCCTTCTGAGTCTCCAGAGTC No data
Right 1198417197 X:136432643-136432665 ATACCATTCTGTATGCCTTTGGG No data
1198417186_1198417197 19 Left 1198417186 X:136432601-136432623 CCTCCTCTCACCCTTCCCCCTTC No data
Right 1198417197 X:136432643-136432665 ATACCATTCTGTATGCCTTTGGG No data
1198417192_1198417197 2 Left 1198417192 X:136432618-136432640 CCCTTCTGAGTCTCCAGAGTCCA 0: 3
1: 78
2: 205
3: 415
4: 829
Right 1198417197 X:136432643-136432665 ATACCATTCTGTATGCCTTTGGG No data
1198417193_1198417197 1 Left 1198417193 X:136432619-136432641 CCTTCTGAGTCTCCAGAGTCCAT 0: 3
1: 94
2: 244
3: 670
4: 1203
Right 1198417197 X:136432643-136432665 ATACCATTCTGTATGCCTTTGGG No data
1198417185_1198417197 25 Left 1198417185 X:136432595-136432617 CCTCATCCTCCTCTCACCCTTCC No data
Right 1198417197 X:136432643-136432665 ATACCATTCTGTATGCCTTTGGG No data
1198417191_1198417197 3 Left 1198417191 X:136432617-136432639 CCCCTTCTGAGTCTCCAGAGTCC 0: 2
1: 87
2: 206
3: 306
4: 516
Right 1198417197 X:136432643-136432665 ATACCATTCTGTATGCCTTTGGG No data
1198417188_1198417197 9 Left 1198417188 X:136432611-136432633 CCCTTCCCCCTTCTGAGTCTCCA No data
Right 1198417197 X:136432643-136432665 ATACCATTCTGTATGCCTTTGGG No data
1198417184_1198417197 26 Left 1198417184 X:136432594-136432616 CCCTCATCCTCCTCTCACCCTTC No data
Right 1198417197 X:136432643-136432665 ATACCATTCTGTATGCCTTTGGG No data
1198417187_1198417197 16 Left 1198417187 X:136432604-136432626 CCTCTCACCCTTCCCCCTTCTGA No data
Right 1198417197 X:136432643-136432665 ATACCATTCTGTATGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198417197 Original CRISPR ATACCATTCTGTATGCCTTT GGG Intergenic
No off target data available for this crispr