ID: 1198421309

View in Genome Browser
Species Human (GRCh38)
Location X:136472771-136472793
Sequence CCAGACATCCTGAAGGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198421309_1198421314 5 Left 1198421309 X:136472771-136472793 CCACTCACCTTCAGGATGTCTGG No data
Right 1198421314 X:136472799-136472821 GGATGATGTGACCAGACCACTGG No data
1198421309_1198421316 19 Left 1198421309 X:136472771-136472793 CCACTCACCTTCAGGATGTCTGG No data
Right 1198421316 X:136472813-136472835 GACCACTGGCCATAGCTAAAAGG No data
1198421309_1198421318 27 Left 1198421309 X:136472771-136472793 CCACTCACCTTCAGGATGTCTGG No data
Right 1198421318 X:136472821-136472843 GCCATAGCTAAAAGGAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198421309 Original CRISPR CCAGACATCCTGAAGGTGAG TGG (reversed) Intergenic
No off target data available for this crispr