ID: 1198422830

View in Genome Browser
Species Human (GRCh38)
Location X:136484897-136484919
Sequence GAGTATGTGCATTTTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198422830_1198422835 14 Left 1198422830 X:136484897-136484919 CCTTGTTCAAAATGCACATACTC No data
Right 1198422835 X:136484934-136484956 ACCTACCAAATCAGAAGCTCTGG No data
1198422830_1198422840 21 Left 1198422830 X:136484897-136484919 CCTTGTTCAAAATGCACATACTC No data
Right 1198422840 X:136484941-136484963 AAATCAGAAGCTCTGGAGGTGGG No data
1198422830_1198422839 20 Left 1198422830 X:136484897-136484919 CCTTGTTCAAAATGCACATACTC No data
Right 1198422839 X:136484940-136484962 CAAATCAGAAGCTCTGGAGGTGG No data
1198422830_1198422837 17 Left 1198422830 X:136484897-136484919 CCTTGTTCAAAATGCACATACTC No data
Right 1198422837 X:136484937-136484959 TACCAAATCAGAAGCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198422830 Original CRISPR GAGTATGTGCATTTTGAACA AGG (reversed) Intergenic
No off target data available for this crispr