ID: 1198424154

View in Genome Browser
Species Human (GRCh38)
Location X:136497766-136497788
Sequence GGTGACACCCAGACCGATGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198424154 Original CRISPR GGTGACACCCAGACCGATGC CGG Exonic
903789296 1:25881624-25881646 GCTGACACCCAGTGGGATGCGGG + Intergenic
908233324 1:62127224-62127246 GGTGACACACAGCCCAAGGCTGG + Intronic
908833306 1:68203446-68203468 AGTGACACCCAGCCCAGTGCTGG - Intronic
912906557 1:113714152-113714174 GGTGAGACTCAGAGCCATGCTGG + Intronic
914689256 1:150010783-150010805 GGTGACACCCAGGCCGCCCCCGG + Intergenic
916369368 1:164073369-164073391 GGTGAGACCCAGTGCTATGCTGG - Intergenic
917306235 1:173628154-173628176 GGTGAGACTCAGAGCCATGCTGG + Intronic
917887216 1:179398540-179398562 GGTGACACCCACATGGAAGCAGG - Intronic
922954589 1:229588360-229588382 GGTGATACCCAGTTCGAGGCTGG + Intergenic
924770674 1:247077118-247077140 GGTGGCAGCCAGTCAGATGCTGG - Intronic
1065892684 10:30134627-30134649 GGTGCCACCCAGGCTGCTGCTGG + Intergenic
1069661790 10:70127802-70127824 GGGGACACCCAGACCAGAGCAGG + Intronic
1069679260 10:70272302-70272324 GGAAACACCCAGACTGATTCTGG - Intronic
1070765906 10:79056281-79056303 GGTGACACTGAGACCCAGGCAGG - Intergenic
1072137386 10:92559981-92560003 TGTGACTCCCAGACTGAGGCAGG - Intronic
1073486229 10:103820647-103820669 GCTCACACCCAGGCCCATGCAGG + Intronic
1077479058 11:2804504-2804526 GGTGACACCCAGCCCTCTGAGGG - Intronic
1080840738 11:35981255-35981277 GGTGACAACCAGAACTCTGCAGG + Intronic
1084031793 11:66485392-66485414 GGTGACACCCACAGTCATGCAGG - Intronic
1084604837 11:70166443-70166465 GGTGCCCCCAAGCCCGATGCTGG + Intronic
1086524545 11:87710549-87710571 GGTGAGACCCAGAGCTGTGCTGG - Intergenic
1088944474 11:114495632-114495654 GGTGAGACTCAGAGCCATGCTGG - Intergenic
1090333870 11:125950306-125950328 GGTGACGCCCAGACCTGTCCTGG + Intergenic
1090829170 11:130408967-130408989 GGTGACACCCATGCGGAAGCAGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1101777232 12:107806126-107806148 GGTGTCACACAGGCAGATGCAGG - Intergenic
1104910832 12:132240264-132240286 GGTGACCCCCAGCCCGATGGCGG - Intronic
1105202860 13:18194609-18194631 GGTGTCACAGAGACCGATGCGGG + Intergenic
1107474578 13:40723033-40723055 GCTGACAGCCAGAACAATGCAGG - Intergenic
1107808135 13:44174195-44174217 GGTGAGACCCAGGGCTATGCTGG - Intergenic
1108062989 13:46552106-46552128 AGTGGCACCCAGGCCAATGCTGG - Intergenic
1109100723 13:58180979-58181001 GGTGAGACTCAGAGCCATGCTGG - Intergenic
1109747744 13:66648246-66648268 GGTGAGACCCAGTGCTATGCTGG + Intronic
1112876343 13:104044365-104044387 GGAGACACACAGACTGCTGCAGG + Intergenic
1116413190 14:44649641-44649663 GATGAGACCCAGGCCCATGCTGG + Intergenic
1117843033 14:59880829-59880851 GGTGAGACTCAGAGCTATGCTGG - Intergenic
1120439674 14:84520536-84520558 GGTGAGACCCAGAGTCATGCTGG - Intergenic
1121560705 14:94873418-94873440 TGTGACACCCAGACCCTTGCTGG + Intergenic
1122289436 14:100672257-100672279 GGGGTCACCCAGGCCCATGCAGG - Intergenic
1123931876 15:25175869-25175891 GGTGACTTCCAGAGGGATGCAGG - Intergenic
1123941266 15:25217721-25217743 GGTGACCCCCAGCGGGATGCGGG - Intergenic
1123945111 15:25235165-25235187 GGTGACCCCCAGAGGGATGTGGG - Intergenic
1125277013 15:38004024-38004046 GGTGAGACTCAGAGCCATGCTGG - Intergenic
1125608856 15:40957625-40957647 GGAGACACCCAGACCAATCCAGG - Intergenic
1125672868 15:41486316-41486338 GGTGGCGCCCAGGCCGGTGCGGG - Intergenic
1126572085 15:50163585-50163607 GGTGACACCCAGTGCTGTGCTGG - Intronic
1131315124 15:91329079-91329101 GGTGAGACTCAGAGCGGTGCTGG - Intergenic
1134232867 16:12442618-12442640 GCTGTCACCCAGACCCAGGCTGG + Intronic
1135148083 16:19980618-19980640 GGTGACATCCAGATCTTTGCAGG - Intergenic
1142298216 16:89241012-89241034 GGTGACCCCCACCCCGAAGCCGG - Intergenic
1143502439 17:7347191-7347213 GGTGACACCAAGGTTGATGCTGG - Exonic
1153356494 18:4143072-4143094 GGTGAGACCCAGTACCATGCTGG - Intronic
1158517917 18:58146295-58146317 GCTCACACCCAGAGCCATGCTGG - Intronic
1160952081 19:1672410-1672432 CGTGACGCCCAGACCGAGGGAGG + Intergenic
1163253910 19:16143458-16143480 GGTGACACGGAGACAGGTGCAGG - Intronic
1164609791 19:29624218-29624240 GTAGACACCCAGACCGAGGCTGG - Intergenic
1166979657 19:46625073-46625095 GCTGACACACAGACCGACACAGG - Exonic
1167291841 19:48629053-48629075 GGTCAGACACAGAACGATGCAGG - Exonic
1167353651 19:48991143-48991165 TAGGACACCCAGACAGATGCAGG - Intronic
925010260 2:479606-479628 TGTGAGACTCAGACGGATGCAGG - Intergenic
927206366 2:20613534-20613556 GGTGACACTCAGAGCTATCCTGG - Intronic
930041424 2:47128294-47128316 GGTGAGACCCAGTACCATGCTGG - Intronic
934755404 2:96820954-96820976 GGTCACAAGCAGCCCGATGCAGG + Intronic
944855095 2:203759828-203759850 GGTGAGACTCAGAGCCATGCTGG - Intergenic
947233928 2:227920444-227920466 TGTGACACCCAAAGGGATGCAGG + Intronic
947892974 2:233643005-233643027 GGTGAGACCCAGAGCTGTGCTGG - Intronic
949077593 2:242070860-242070882 GGTGACAGCCAGGCAGATGCTGG - Intergenic
1168970501 20:1927579-1927601 GGTGAGACCCAGACAGAGGTAGG + Intronic
1175632077 20:60549871-60549893 GGTGAGACCCAGTACCATGCTGG - Intergenic
1176715096 21:10343396-10343418 GGTGTCACAGAGACCGATGCGGG - Intergenic
1180173805 21:46077843-46077865 GGGGGCATCCAGACCGAAGCAGG - Intergenic
1180603250 22:17036542-17036564 GGTGTCACAGAGACCGATACCGG + Intergenic
1183718405 22:39547944-39547966 GGGGACCCCCAGACCTCTGCAGG + Intergenic
1184802115 22:46767797-46767819 GAGGACTCCCAGAGCGATGCTGG + Intronic
952132713 3:30383856-30383878 GGTGAGACCCAGTGCCATGCTGG - Intergenic
953722675 3:45369786-45369808 GGTGAGACCCAGAGCTATGTTGG + Intergenic
958670372 3:97196934-97196956 GGTGAGACCCAGTGCTATGCTGG - Intronic
959640147 3:108623292-108623314 GGTGAGACTCAGAGCTATGCTGG - Intronic
961339258 3:126206126-126206148 GGTCATACCCAGATCTATGCTGG + Intergenic
961610395 3:128132770-128132792 GGTGAGACCCAGTGCCATGCTGG + Intronic
963020480 3:140868781-140868803 GGTGACACTCAGAGATATGCTGG - Intergenic
967818971 3:193823661-193823683 GGTGACACTAAGACAGATGAAGG - Intergenic
976453838 4:85223059-85223081 GGTGACAGCCAGTGCTATGCTGG - Intergenic
978654470 4:111049569-111049591 GGTGAAACCCAGTGCTATGCTGG + Intergenic
979184628 4:117772745-117772767 GGTGAGACCCAGAGCCATGTTGG + Intergenic
979564980 4:122145128-122145150 GGTAACACCCAGTGCTATGCTGG - Intergenic
979573092 4:122252843-122252865 GGTGAGACCCAGTGCTATGCTGG + Intronic
980682892 4:136187217-136187239 GGTGAGACTCAGAGCCATGCTGG + Intergenic
981140326 4:141260032-141260054 GGTGAGACCCAGAGCTGTGCTGG + Intergenic
988608524 5:32703472-32703494 GGTGAAACCCAGGGCTATGCTGG - Intronic
991030574 5:62078084-62078106 GGTGACAGACAGAGCAATGCTGG - Intergenic
991662175 5:68961601-68961623 AGTGTCACCCAGACCAAAGCTGG - Intergenic
995049737 5:107688543-107688565 GTTGACACCCAGTTCTATGCTGG + Intergenic
995557538 5:113344814-113344836 GGTGAGACTCAGAGCTATGCTGG + Intronic
995573174 5:113502982-113503004 GGTGAGACTCAGAACCATGCTGG - Intergenic
996133299 5:119808892-119808914 GGTGAGACCCAGCACTATGCTGG - Intergenic
996245858 5:121263270-121263292 GGAGGCAGCCAGACCCATGCAGG - Intergenic
996927640 5:128846691-128846713 GGTGACACCCAGTGCTGTGCTGG + Intronic
1001271524 5:170315892-170315914 GGTGATACACAGACAGGTGCTGG - Intergenic
1003623248 6:7720839-7720861 GGTGAGACCCAGAACGAAGAAGG - Intergenic
1005037419 6:21569670-21569692 GGTGAGACTCAGAGCTATGCTGG - Intergenic
1006963832 6:37961545-37961567 GGTGAAACCCAGTGCTATGCTGG + Intronic
1010596523 6:77769876-77769898 GGTGAGACCCAGAGCCATGTTGG + Intronic
1018869268 6:167768932-167768954 GGTGACACACTGACCCAGGCAGG - Intergenic
1019870751 7:3758660-3758682 GGTGACACACAGAACAAGGCTGG - Intronic
1025718185 7:63983277-63983299 GGTGAGACCCAGAGCTGTGCTGG + Intergenic
1029572353 7:101378621-101378643 GGGGACACCAAGACCGGTGGGGG + Intronic
1030370391 7:108693608-108693630 GGTGAGACCCAGCGCCATGCTGG - Intergenic
1035536148 8:392745-392767 GGTGACAGCCAGGCAGATGCTGG - Intergenic
1040969781 8:53122655-53122677 GATGTCACCCAGACCCATGGTGG - Intergenic
1043627083 8:82274377-82274399 GGTGAGACCCAGTGCTATGCTGG + Intergenic
1044878058 8:96692375-96692397 GGTGAGACCCAGTGCTATGCTGG + Intronic
1046463189 8:114569472-114569494 GGTGAGACCCAGTACCATGCTGG - Intergenic
1046778926 8:118194557-118194579 GCTGACACCCAGACTTGTGCAGG - Intronic
1049352318 8:142170837-142170859 GATCACACCCAGACTGATGCAGG - Intergenic
1049414961 8:142490936-142490958 GGTGACACGGAGGCCCATGCGGG - Intronic
1050135770 9:2462026-2462048 GCTGACATCCAGACTGGTGCAGG + Intergenic
1050343929 9:4667514-4667536 GCTGACACCCAGAGTGATGTGGG + Intergenic
1060129576 9:121081952-121081974 GGTGACACCCAGACAGCTTTGGG - Intronic
1060527828 9:124330514-124330536 GGTCACACCCAGGCCCATGCAGG + Intronic
1060720313 9:125972198-125972220 GGTGGCGCCCAGACGGAAGCAGG - Intergenic
1189593945 X:42544164-42544186 GGTGAGACCCAGTGCTATGCTGG + Intergenic
1189868704 X:45359965-45359987 GGTGAGACCCAGTGCTATGCTGG - Intergenic
1191210466 X:57879418-57879440 GGTGACATGCAGATCGATGCTGG + Intergenic
1192069614 X:67923228-67923250 GGTGAGACTCAGAGCCATGCTGG + Intergenic
1193175263 X:78384798-78384820 GGTGAGACCCAGCACTATGCTGG + Intergenic
1193191141 X:78572645-78572667 GGTGAGACTCAGAGAGATGCTGG - Intergenic
1193665516 X:84310670-84310692 GGTGAGACCCAGTGCTATGCTGG + Intergenic
1195289955 X:103423155-103423177 GGTGAGACCCAGTGCTATGCTGG - Intergenic
1196233410 X:113252428-113252450 GGTGACACCCAGTACTGTGCAGG - Intergenic
1196877632 X:120169620-120169642 GGTGAGACCCAGTCCTGTGCTGG - Intergenic
1197439319 X:126470956-126470978 GGTGAGACTCAGAGCTATGCTGG + Intergenic
1197487739 X:127074771-127074793 GGTGAGACCCAGGGCCATGCTGG - Intergenic
1198424154 X:136497766-136497788 GGTGACACCCAGACCGATGCCGG + Exonic
1198612091 X:138412331-138412353 GGTGAGACCCAGTGCTATGCTGG + Intergenic
1199156229 X:144551719-144551741 GGTGAAACCCAGTGCTATGCTGG + Intergenic