ID: 1198424183

View in Genome Browser
Species Human (GRCh38)
Location X:136497883-136497905
Sequence CACGGGCGCCACTGCAGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198424176_1198424183 -4 Left 1198424176 X:136497864-136497886 CCCCAAGGTAGGAGAGTGCCACG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1198424183 X:136497883-136497905 CACGGGCGCCACTGCAGAGCGGG 0: 1
1: 0
2: 0
3: 18
4: 112
1198424173_1198424183 17 Left 1198424173 X:136497843-136497865 CCTGGACAAAAAGGCTTGGTTCC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1198424183 X:136497883-136497905 CACGGGCGCCACTGCAGAGCGGG 0: 1
1: 0
2: 0
3: 18
4: 112
1198424179_1198424183 -6 Left 1198424179 X:136497866-136497888 CCAAGGTAGGAGAGTGCCACGGG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1198424183 X:136497883-136497905 CACGGGCGCCACTGCAGAGCGGG 0: 1
1: 0
2: 0
3: 18
4: 112
1198424170_1198424183 30 Left 1198424170 X:136497830-136497852 CCTACGAGTGGGACCTGGACAAA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1198424183 X:136497883-136497905 CACGGGCGCCACTGCAGAGCGGG 0: 1
1: 0
2: 0
3: 18
4: 112
1198424177_1198424183 -5 Left 1198424177 X:136497865-136497887 CCCAAGGTAGGAGAGTGCCACGG 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1198424183 X:136497883-136497905 CACGGGCGCCACTGCAGAGCGGG 0: 1
1: 0
2: 0
3: 18
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198424183 Original CRISPR CACGGGCGCCACTGCAGAGC GGG Intronic
900109860 1:1000784-1000806 CACGGGTGGCCCCGCAGAGCAGG + Intergenic
901166129 1:7222823-7222845 AGCTGGCACCACTGCAGAGCTGG - Intronic
917869800 1:179230802-179230824 GACGGGAGCCACTGCAAAGAAGG + Intergenic
920724247 1:208418785-208418807 CAGGGGACCCTCTGCAGAGCCGG - Intergenic
923986344 1:239386851-239386873 CGGGGGCGGCACTGCCGAGCCGG + Intronic
924436851 1:244049385-244049407 CCCGGGCGCCACTGCAGCTGCGG - Intronic
1063067087 10:2621061-2621083 CTGGGGGGCCTCTGCAGAGCTGG + Intergenic
1064059998 10:12129533-12129555 CACGGGCGCCGGGGCAGGGCGGG - Intergenic
1065014299 10:21447674-21447696 CCTGGGCTTCACTGCAGAGCTGG - Intergenic
1070707499 10:78651264-78651286 CAAGGGCCACACTGCAGAGATGG - Intergenic
1071456754 10:85857127-85857149 CAGTGACTCCACTGCAGAGCAGG - Intronic
1072283779 10:93894105-93894127 CCCGGGCGCCACTGAGGAGCCGG + Exonic
1075395530 10:122124306-122124328 CACTGGGACCACTGCAGAGGAGG - Intronic
1076328561 10:129647171-129647193 CGCAGGCGCCTCCGCAGAGCAGG - Intronic
1076716366 10:132366226-132366248 GAGGGGCGTCACTGCAGAGAGGG + Intronic
1077367414 11:2166780-2166802 CACGCGGGTCACTGCCGAGCCGG + Intronic
1078021323 11:7657888-7657910 TACAGGAGCCAGTGCAGAGCAGG - Intergenic
1083207526 11:61161500-61161522 CACGCGCGCCACTGGGGCGCCGG - Exonic
1083397040 11:62399473-62399495 CAGGGAGGCCACTGTAGAGCTGG - Intergenic
1084174984 11:67418388-67418410 CAAGGGCGCCCCTGGTGAGCTGG + Intronic
1085772715 11:79339469-79339491 CAAGGGCGCCTGTGCAGAGCTGG + Intronic
1087188748 11:95230913-95230935 CACTGCGGCCACTGCAGGGCCGG + Exonic
1089375093 11:117988478-117988500 CAGGAGCGCCACTTCATAGCAGG - Exonic
1090658181 11:128861598-128861620 CCTGGGAGCCACTGCAGAGCGGG + Intronic
1092183611 12:6462824-6462846 CAAGGGCGGGACTGAAGAGCTGG - Intronic
1093444610 12:19242381-19242403 GATGGGCGCCACTGCACACCTGG + Intronic
1093464893 12:19439582-19439604 CGCCGACGCCGCTGCAGAGCAGG - Intronic
1097088656 12:56488133-56488155 CCCGGGCGCACCTGCAGAGCCGG - Exonic
1098382841 12:69886900-69886922 CATGGTTGCCACTTCAGAGCAGG - Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1103158265 12:118706220-118706242 CAGGGGTGCCAGGGCAGAGCAGG - Intergenic
1104661859 12:130617006-130617028 CATGGGGGCCTCTGCAGAGGAGG - Intronic
1105304264 13:19158059-19158081 TGCAGGAGCCACTGCAGAGCAGG - Intergenic
1105888078 13:24659766-24659788 GACGGGCACAACTGCACAGCTGG - Intergenic
1111975928 13:94967693-94967715 CACGGGCGCCGCCGCAGACCCGG + Intergenic
1118821523 14:69349202-69349224 CACCAGCCCCACTGCAGGGCAGG - Intronic
1121895058 14:97639229-97639251 CAGGGGGCCCACTGCACAGCAGG - Intergenic
1123992209 15:25692036-25692058 TAAGAGCGGCACTGCAGAGCAGG - Intronic
1124223408 15:27869270-27869292 CACAGCGGCCACTGCAGAGATGG + Intronic
1124562200 15:30784899-30784921 CAGAGGTGACACTGCAGAGCAGG - Intergenic
1127640971 15:60915397-60915419 CACAGGCCCCAGTGCAGAGGAGG + Intronic
1129181048 15:73875741-73875763 GAAAGGCACCACTGCAGAGCTGG + Intronic
1132496470 16:265684-265706 CACGGGCTCAGCTCCAGAGCAGG - Exonic
1132883901 16:2174012-2174034 CAGAGGAGCCACTGAAGAGCAGG - Exonic
1133891781 16:9886018-9886040 CAAGGAGGCCACTGCAGTGCAGG - Intronic
1134238468 16:12486318-12486340 TACAGGGGCCACTGCAGAGGAGG - Intronic
1135175816 16:20227783-20227805 TACGGATGCCACTGCAAAGCTGG - Intergenic
1138368358 16:56502391-56502413 CATGGACACCAGTGCAGAGCAGG - Exonic
1141944428 16:87299507-87299529 CACGGTGGCCACTGCAGATACGG + Intronic
1142032803 16:87846847-87846869 CACGGGAGCCACTGCCATGCAGG - Intronic
1145218537 17:21070082-21070104 GACGGCAGCCACTGCAGGGCTGG + Intergenic
1145230821 17:21172168-21172190 CACAGGCGCCACCTCAGGGCTGG + Exonic
1147191777 17:38742121-38742143 CACGGTGGCCAATCCAGAGCCGG - Intronic
1149510425 17:57236847-57236869 CACAGGCGGCACTGCAGTGATGG - Intergenic
1150676046 17:67246097-67246119 CGCGGGCGCCGCTGCAGCTCGGG + Intergenic
1152225358 17:79090291-79090313 CACGGGCGGGACTGCCGGGCAGG + Intronic
1152278336 17:79371119-79371141 CCCAGGCCCCAGTGCAGAGCAGG - Intronic
1155648477 18:28111106-28111128 CAGGGGCGCCACTGCAGACTGGG - Intronic
1156492140 18:37502596-37502618 CCCGGGCCCCACTGCACTGCTGG + Intronic
1157926909 18:51776762-51776784 GATGGGTGGCACTGCAGAGCTGG + Intergenic
1160555933 18:79725261-79725283 CACGGGAGCCACAGCAAACCTGG - Intronic
1160575936 18:79853833-79853855 GACGGGCGCCACCCCAGGGCGGG + Intergenic
1160772908 19:841025-841047 CACGGACGCCAGGGCAGGGCTGG - Exonic
1160857653 19:1224590-1224612 CACGGCCGCCCCTGCAGGCCAGG + Intronic
1163607304 19:18282084-18282106 CCCTGGCGGCACAGCAGAGCAGG - Intergenic
1164805084 19:31110243-31110265 GACGGGCCACACTGAAGAGCAGG + Intergenic
925922455 2:8646799-8646821 AAGGGGCCCCAGTGCAGAGCTGG + Intergenic
925996591 2:9298567-9298589 CGAGGGCTCCACTGCTGAGCAGG - Intronic
926084105 2:10010262-10010284 AACGGGCCACACTGGAGAGCAGG + Intergenic
927558030 2:24049733-24049755 CCTCGCCGCCACTGCAGAGCCGG - Exonic
927868946 2:26611242-26611264 GACAGGCGCCACAGCAGTGCTGG - Intronic
928401473 2:30981660-30981682 GAGGGGCACCACTGCCGAGCAGG + Intronic
930990729 2:57650812-57650834 CAGGGGAGCCAAGGCAGAGCTGG - Intergenic
933888815 2:86745914-86745936 CACTGAGGCCATTGCAGAGCTGG + Intronic
934572191 2:95379745-95379767 CTCAGGCGCTGCTGCAGAGCAGG + Intronic
936770266 2:115904025-115904047 CACGAGAGCAGCTGCAGAGCAGG - Intergenic
941498812 2:166242501-166242523 CCAGGGCACCACTGCTGAGCAGG + Exonic
948603756 2:239121897-239121919 CTGGGGCTGCACTGCAGAGCTGG + Intronic
1172793639 20:37522820-37522842 CACGGGAGCCAGTGCCGCGCAGG + Exonic
1173658057 20:44714704-44714726 CACGGGCCCCCTTCCAGAGCCGG + Intergenic
1173897588 20:46562651-46562673 CACTGGGGGCACTGCAGAGTGGG - Intronic
1176207182 20:63895403-63895425 CGGGGGCGGCACTCCAGAGCCGG + Intronic
1179805455 21:43834411-43834433 CACAGGCTCCCCTGCAGGGCGGG - Intergenic
1181807898 22:25386115-25386137 CTGGTGCTCCACTGCAGAGCTGG + Intronic
1184047559 22:41980929-41980951 CATGAGCACCACTGCAGAGTAGG - Intronic
1184310436 22:43637736-43637758 GACAGGCTCCTCTGCAGAGCTGG - Intronic
1185055052 22:48575216-48575238 CAGGGGCCTCACTGCAGAGCCGG - Intronic
951717483 3:25664604-25664626 CGCGGGCGCCGCTGCAGGCCGGG + Intronic
953304037 3:41809611-41809633 CAGAGGTGACACTGCAGAGCAGG - Intronic
953304683 3:41817005-41817027 CAGAGGTGACACTGCAGAGCAGG + Intronic
954545089 3:51427087-51427109 CACGGCCACAGCTGCAGAGCTGG - Intronic
961551575 3:127672916-127672938 TCCGGACGCCGCTGCAGAGCGGG + Intronic
961825323 3:129596318-129596340 CCCAGGCGCCAGGGCAGAGCAGG - Intronic
967932887 3:194703130-194703152 CACTGAGGCCACTGCAGAGCTGG + Intergenic
968568868 4:1328980-1329002 CACGGAGGCCAGAGCAGAGCGGG - Intronic
968922671 4:3530792-3530814 CCAGGGCGGCCCTGCAGAGCAGG + Intronic
969052487 4:4383156-4383178 CACAGGCTTCCCTGCAGAGCTGG - Intronic
975743370 4:77452337-77452359 CACGTGCTCCTCTGCAGAGAGGG + Intergenic
980859800 4:138485617-138485639 CAAGGGAGCCACTGCATGGCTGG - Intergenic
982281051 4:153684168-153684190 CACGTGCGCCGCTGCGCAGCCGG - Intergenic
985518911 5:361550-361572 GAGTGGGGCCACTGCAGAGCTGG + Intronic
986705734 5:10453262-10453284 CGCGGGAGCCAGGGCAGAGCAGG - Intronic
987647014 5:20686747-20686769 CACAGGTGCCACTGCAGAGTAGG - Intergenic
991127209 5:63082894-63082916 CACGTGCTCCTCTGCAGAGAGGG - Intergenic
991164295 5:63544430-63544452 CAAGGGGGCTTCTGCAGAGCTGG + Intergenic
1002321100 5:178376483-178376505 CAGGGGCACCAATGCAGTGCAGG - Intronic
1002632757 5:180591780-180591802 CACGCGCCCCCCTGCAGGGCTGG + Intergenic
1017021484 6:150143345-150143367 CACGGCGGCCGCTGCAGGGCAGG + Exonic
1018731419 6:166654374-166654396 CACGGGCCCCACTGCCGGCCGGG + Intronic
1024255384 7:47536926-47536948 CACGGGCACCAGTGCACACCCGG + Intronic
1027271101 7:76519416-76519438 CATGGGTGCCACTGCAGAACAGG - Intergenic
1027320864 7:77009351-77009373 CATGGGTGCCACTGCAGAACAGG - Intergenic
1033227717 7:139574479-139574501 CACGGGCTCCACTGATGACCTGG + Intronic
1033345616 7:140523487-140523509 CACTGGAGCCACTGCAGGGCAGG + Intronic
1035888551 8:3320193-3320215 CACGGGCCCCACTGCTTAGTTGG - Intronic
1036685026 8:10903915-10903937 CAAGTGAGCCACTGCAGAGAAGG - Intronic
1037887228 8:22601508-22601530 CACGGCCACCTCTGCAGAGGAGG + Intronic
1042560816 8:70071165-70071187 CAAGAGCGCCACCGCGGAGCGGG + Exonic
1048441361 8:134461954-134461976 CAGGGCAGCCACTGCAGACCTGG - Intergenic
1049377719 8:142296898-142296920 CACGGGAGACAGTGGAGAGCAGG - Intronic
1049549658 8:143251222-143251244 CAGGGGCCCCACTGCATGGCTGG - Exonic
1049587142 8:143437398-143437420 CACGGGCACCCGTGCAGGGCAGG + Intergenic
1049751472 8:144286327-144286349 CACGGGCGCCATGGCAGGGCAGG + Intronic
1049751488 8:144286392-144286414 CATGGGCGCCACGGCAGGGCAGG + Intronic
1049751505 8:144286457-144286479 CATGGGCGCCACGGCAGGGCAGG + Intronic
1049751522 8:144286522-144286544 CATGGGCGCCACGGCAGGGCAGG + Intronic
1049751538 8:144286587-144286609 CACGGGCGCCATGGCAGGGCAGG + Intronic
1057621016 9:96635090-96635112 CATGGACTGCACTGCAGAGCAGG - Intergenic
1061059795 9:128244698-128244720 CACCGCCGCCACTGGAGAGCTGG - Intronic
1062564809 9:137159463-137159485 CACAGGGGCCGGTGCAGAGCAGG - Intronic
1198424183 X:136497883-136497905 CACGGGCGCCACTGCAGAGCGGG + Intronic