ID: 1198426513

View in Genome Browser
Species Human (GRCh38)
Location X:136526128-136526150
Sequence CTGTGCACAGAGTTGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198426511_1198426513 3 Left 1198426511 X:136526102-136526124 CCAGGGGTGAATACTACAGCAAG No data
Right 1198426513 X:136526128-136526150 CTGTGCACAGAGTTGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198426513 Original CRISPR CTGTGCACAGAGTTGGAACA TGG Intergenic
No off target data available for this crispr