ID: 1198427596

View in Genome Browser
Species Human (GRCh38)
Location X:136535601-136535623
Sequence AGGTTGGCCCAGAACTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198427596_1198427599 -6 Left 1198427596 X:136535601-136535623 CCATGGTAGTTCTGGGCCAACCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1198427599 X:136535618-136535640 CAACCTTGGCTCATTCGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1198427596_1198427603 16 Left 1198427596 X:136535601-136535623 CCATGGTAGTTCTGGGCCAACCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1198427603 X:136535640-136535662 GAGAAAGGCACTTCCCCAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 373
1198427596_1198427602 13 Left 1198427596 X:136535601-136535623 CCATGGTAGTTCTGGGCCAACCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1198427602 X:136535637-136535659 TAGGAGAAAGGCACTTCCCCAGG 0: 1
1: 0
2: 2
3: 17
4: 207
1198427596_1198427601 1 Left 1198427596 X:136535601-136535623 CCATGGTAGTTCTGGGCCAACCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1198427601 X:136535625-136535647 GGCTCATTCGTTTAGGAGAAAGG 0: 1
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198427596 Original CRISPR AGGTTGGCCCAGAACTACCA TGG (reversed) Intronic
900610546 1:3542842-3542864 AGGATGGCCCAGGCCTTCCAGGG - Intronic
901940443 1:12657749-12657771 TGGGTGTCCCAGAACTGCCATGG + Intronic
902109672 1:14067755-14067777 TGGTTGCCCCAGAACTTTCAAGG - Intergenic
903231946 1:21927441-21927463 AGGTTGGCCCAGAGCTCCCCAGG + Intronic
906725757 1:48042960-48042982 AGGTTGACCCAAATCTCCCAGGG - Intergenic
909181740 1:72433023-72433045 AGGCTGCCACAGAACTGCCACGG + Intergenic
911502770 1:98709055-98709077 AACTTGGCCCAGAACTACAAAGG - Intronic
915399865 1:155614229-155614251 AGCCTGGCCCAGTGCTACCAGGG + Exonic
915417023 1:155750093-155750115 AGCCTGGCCCAGTGCTACCAGGG + Exonic
919778454 1:201208537-201208559 AGGATGGATCAGAACTTCCAGGG + Exonic
920073647 1:203321412-203321434 AGGTAGACCCAGTACTACCTGGG - Intergenic
920451871 1:206065528-206065550 AGGTTGGTCAAGTACTAACAAGG + Intronic
921049422 1:211500531-211500553 AAGTGGGCCCAGTACTCCCAGGG + Intergenic
923409110 1:233689968-233689990 AGGTTTGCCCAGAACTATCCTGG - Intergenic
1063465926 10:6244402-6244424 AAGTTGGTCCAGAAAGACCATGG - Intergenic
1068811303 10:61258525-61258547 ATCATGGCACAGAACTACCATGG + Intergenic
1068885307 10:62091654-62091676 AGTTTGTCCCAGACCCACCATGG + Exonic
1069855509 10:71438880-71438902 AGTCTGGCCCTGCACTACCAGGG + Intronic
1073597543 10:104816162-104816184 ATGCTGGCCCAGACCTGCCAGGG - Intronic
1083328054 11:61883674-61883696 AGGTGGCCCCAGAACTGACATGG - Intronic
1083998537 11:66283930-66283952 GGGATGGCCCAGAATTTCCAGGG - Exonic
1093174843 12:15901647-15901669 AGGTTGGTCTTGAACTACCAAGG - Intronic
1096179040 12:49540551-49540573 AGGCTGGCCCAGAGCTGGCAGGG + Intronic
1101735063 12:107457181-107457203 AGGTTTGCCCAGGATTATCAAGG - Intronic
1102442876 12:112977150-112977172 AGGTTTTTCCAGAACTAACAGGG + Intergenic
1103561291 12:121794379-121794401 AGGTTGGCCCGAAACCACTAGGG + Intronic
1104406344 12:128520333-128520355 AGCTGGGCCCAGGACTACCCAGG + Intronic
1107903666 13:45042993-45043015 GGGTTGGCCCAGAATAAACAGGG + Intergenic
1109153521 13:58874515-58874537 AGGTTTCCCCAGAACTGTCATGG + Intergenic
1113636462 13:111922261-111922283 AGGTTGGCCCAGCTCCCCCAGGG + Intergenic
1114500382 14:23164047-23164069 ACTGTGGCCCAGAACTCCCAGGG + Intronic
1118158384 14:63263919-63263941 AGGATGGCCAAGAGCTACCCAGG - Intronic
1119784342 14:77301214-77301236 AGGCTGAGCCAGAACCACCAGGG + Exonic
1120009928 14:79402144-79402166 AGGCTGGCCTAGAACTCCCTGGG + Intronic
1125551540 15:40548706-40548728 ATGCCGGCTCAGAACTACCAAGG + Intronic
1128511267 15:68315463-68315485 AGGTTGGCCCACACCTGCAACGG + Intronic
1134028034 16:10969557-10969579 AGGTTGGCCTTGAACTTCCGGGG + Intronic
1135143469 16:19941044-19941066 AGATTCTCCCAGAACTCCCACGG - Intergenic
1140043381 16:71424355-71424377 ACAGTGGCCCAGAACTAGCAGGG - Intergenic
1141253949 16:82383668-82383690 AGGTTGGCCCAGAGTTACGAAGG - Intergenic
1143258568 17:5582308-5582330 AGGGTGGTCCAGAAGTTCCAAGG - Intronic
1144370574 17:14586740-14586762 ATTTTGGCCCAGAACTCCTAAGG - Intergenic
1146262729 17:31432257-31432279 AGGTTTGCCCAGGACTGCCCTGG - Intronic
1146751957 17:35389806-35389828 AGAGTGGCCCAGAATTACCCTGG - Intergenic
1146913972 17:36666319-36666341 AGGGTGACCCAGAACTACACAGG + Intergenic
1147653508 17:42075345-42075367 ATGAAGGCCCAGAACTACCCTGG - Intergenic
1150124858 17:62629080-62629102 AGGTGGGCCCAGAATTGCCCCGG - Intronic
1150651121 17:67010815-67010837 AGGTTTTCCCAGAACTACTCAGG - Intronic
1152438224 17:80288973-80288995 AGGTGGGCCCCGAGGTACCATGG + Intronic
1153521217 18:5955775-5955797 AGCTTGGCTCAGATCTGCCATGG - Exonic
1155316860 18:24580294-24580316 AGGTTACCCCTAAACTACCATGG - Intergenic
1157735557 18:50045603-50045625 AGGCTGGCCTAGAACTGCCCAGG + Intronic
1164521628 19:28984118-28984140 AGCTAGGCCCAGGACTCCCAGGG + Intergenic
928169324 2:28993354-28993376 AGGCTGGCACAGACCTTCCATGG - Intronic
936145198 2:109976091-109976113 AGGTAGGCCCAGTACCACCCGGG + Intergenic
936199487 2:110395387-110395409 AGGTAGGCCCAGTACCACCCGGG - Intergenic
938096263 2:128466085-128466107 AGCTTGGCCCACACCCACCAAGG - Intergenic
938756801 2:134388067-134388089 AGGGAGGCACAGAACTAACATGG + Intronic
948528301 2:238587088-238587110 AGGGCAGCCCAGAAGTACCAGGG - Intergenic
1173959142 20:47057790-47057812 AGGTTGGCCCAAAAGAACTAAGG + Intronic
1174148218 20:48467460-48467482 AGGTTTGCCCAGAACTCTCTTGG + Intergenic
1178373342 21:32046287-32046309 ACAGAGGCCCAGAACTACCAGGG + Intergenic
1179874137 21:44259063-44259085 AGGATGGCCCAGAAGGACCGAGG + Intronic
1182738057 22:32545224-32545246 GGGCTGGCCTGGAACTACCATGG - Intronic
1183252963 22:36743373-36743395 AGGTTGCCCCAAAAGTAGCATGG - Intergenic
968331949 3:197878387-197878409 AGGCTGGCCCATAACAAACATGG - Intronic
969490791 4:7498215-7498237 AGGTTGGCCCACAGCCATCAGGG - Intronic
980599086 4:134995815-134995837 AGGTTTTCCCATAACTACCTGGG + Intergenic
983855703 4:172641359-172641381 AGTTGGGCCCAGAACTGGCAGGG - Intronic
993047296 5:82881717-82881739 AGGTTGGCCAATAACTAATAAGG + Intergenic
997191410 5:131940125-131940147 AGAGTGCCACAGAACTACCAGGG + Intronic
997372541 5:133371063-133371085 AGCATTGCCCAGAACTACCCAGG - Intronic
999206460 5:149851800-149851822 TCCTTGGCCCAGAACCACCATGG + Exonic
1002093918 5:176819742-176819764 AGGTTGGGCCGGAGCCACCAAGG + Intronic
1003179936 6:3782713-3782735 AGGTTTGCACACCACTACCAAGG + Intergenic
1003992147 6:11496878-11496900 ATGTTGGCTCAGAACATCCAAGG + Intergenic
1005820976 6:29598926-29598948 AGGGTGTCCTAAAACTACCAAGG + Intronic
1006625145 6:35392498-35392520 AGATTGGCCCAGGAATTCCAAGG + Intronic
1013098655 6:106969064-106969086 AGGTTGTCCCTGAACCACCTCGG + Intergenic
1015822685 6:137280754-137280776 AGGTTGGTCTTGAACTACCTGGG + Intergenic
1017717352 6:157222235-157222257 AGGGTGACCCAGGACTTCCAGGG - Intergenic
1020505283 7:8979241-8979263 AGGATAGCCCTGAACAACCAGGG + Intergenic
1023101855 7:36726155-36726177 ATGATGGCCTACAACTACCATGG - Intergenic
1023482475 7:40648771-40648793 AGGATGGCCTGCAACTACCAGGG + Intronic
1024055689 7:45658775-45658797 AGCCTGGCCCTGAACTACAACGG - Intronic
1025234248 7:57223176-57223198 AGGTTTGCCCAGAACTTTCCCGG - Intergenic
1027425917 7:78061473-78061495 TGGTTGGCTCAAAACTACCTTGG - Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1034816820 7:154179013-154179035 AGGATGGCCCAGAAGCAACAGGG + Intronic
1039828607 8:41195267-41195289 TGGTTGGCCCAGAGCCACCTGGG - Intergenic
1055646650 9:78367743-78367765 AGGCAGGGCCAGGACTACCATGG + Intergenic
1057160769 9:92886728-92886750 AGGTTGGGCCAGACCAACGAGGG + Intergenic
1059235877 9:112760344-112760366 AGGTTGGGACAGAAATACCCTGG + Intronic
1059926458 9:119214275-119214297 AGGTTGGCCCAGAAATATATTGG - Intronic
1060668504 9:125447929-125447951 TGGTTTGCCCAGAGCTCCCATGG - Intronic
1197445881 X:126552163-126552185 AGGCTGGCCCAGGACCAACAGGG - Exonic
1198427596 X:136535601-136535623 AGGTTGGCCCAGAACTACCATGG - Intronic
1200273937 X:154714244-154714266 AGGATGACCCAGAACTAACTAGG + Intronic
1201938482 Y:19433257-19433279 ATGTTGGCTCAGAAATACAATGG + Intergenic
1202142122 Y:21735810-21735832 AGTTTGACCCAGAACTAACCGGG - Intergenic
1202144743 Y:21767992-21768014 AGTTTGACCCAGAACTAACCGGG + Intergenic