ID: 1198428228

View in Genome Browser
Species Human (GRCh38)
Location X:136540863-136540885
Sequence CTGTTAGTAAGTGATGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 744
Summary {0: 1, 1: 4, 2: 22, 3: 122, 4: 595}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198428228 Original CRISPR CTGTTAGTAAGTGATGGAGC TGG (reversed) Intronic
900691337 1:3982314-3982336 CTTTCAGGAAGTGAGGGAGCTGG + Intergenic
901663034 1:10810668-10810690 CGGCTAGTAAGTGGTAGAGCTGG - Intergenic
901760868 1:11470497-11470519 CAGCTAGTAAGCGACGGAGCTGG + Intergenic
901789159 1:11644918-11644940 CTGCTAAGAAGTGATGGAACTGG - Intergenic
901914741 1:12489886-12489908 CAGTTCGTAAGTGGTGGAGCTGG + Intronic
902072773 1:13754810-13754832 CTGTTTGCAGGTGCTGGAGCAGG + Intronic
902756835 1:18554466-18554488 CAATCAGTAAGTGCTGGAGCTGG + Intergenic
902996693 1:20230968-20230990 CAACTAGTAAGTGATGGAACTGG - Intergenic
903182296 1:21611053-21611075 CTTTTAGTCCGTGAAGGAGCTGG - Intronic
903710043 1:25316693-25316715 CAGCTAGTAAGTGACAGAGCTGG + Intronic
903717073 1:25375713-25375735 CAGCTAGTAAGTGACAGAGCTGG - Intronic
903805390 1:26001788-26001810 CAGTTAGTAAGTGGTAGAGCTGG - Intergenic
903894025 1:26590941-26590963 CTTTTAGAAAGTGGTAGAGCTGG + Intergenic
903981703 1:27193447-27193469 CAACTAGTATGTGATGGAGCTGG + Intergenic
904259628 1:29280966-29280988 CAGCTAGTAAGTGGTGGAGCTGG + Intronic
904473838 1:30751929-30751951 CTGCTGGTAAGTAATGGAGATGG + Intronic
904537276 1:31208142-31208164 CGGCTAGTAAATGATGGAGTGGG - Intronic
904819693 1:33233836-33233858 TATTTAGGAAGTGATGGAGCTGG - Intergenic
905213024 1:36387255-36387277 CAGCTTGTAAGTGATGCAGCAGG - Intergenic
905304844 1:37010445-37010467 CAGTCAGGAAGTGGTGGAGCCGG + Intronic
905507057 1:38488493-38488515 CAGCTAGGAAGTGATGGAGCTGG - Intergenic
906636611 1:47414659-47414681 CTAGTAGTAAGTGGTAGAGCTGG - Intergenic
906644357 1:47463188-47463210 ATTGTAGGAAGTGATGGAGCAGG + Intergenic
906899544 1:49818974-49818996 CTGTTAGTAAATGATAGAGCTGG - Intronic
906998235 1:50821581-50821603 CTCCTAGTAAGTGCTGGAGCTGG - Intronic
907054501 1:51352546-51352568 CAGCTAGTAAGTGGTAGAGCTGG - Intergenic
907170944 1:52464027-52464049 CAGCTAGTAATTGTTGGAGCCGG - Intronic
907262906 1:53234938-53234960 CTGCTAGTAAGAGATACAGCAGG - Intronic
907304767 1:53507357-53507379 GTGTGAGTAAGGGGTGGAGCTGG + Intronic
907716478 1:56930986-56931008 CAGTTATTAAATGATGGAGATGG + Intronic
907716536 1:56931646-56931668 CAGTTATTAAATGATGGAGATGG + Intronic
907778943 1:57546456-57546478 CAGTTAGCAAGTGGTTGAGCTGG - Intronic
907795138 1:57708578-57708600 CAGTTAGTCAGTGGTGAAGCTGG + Intronic
907975599 1:59428353-59428375 CAGCTAATAGGTGATGGAGCTGG + Intronic
908276848 1:62482283-62482305 CTGTTAGTAAGTGGTGGAGTGGG + Intronic
908323959 1:63005374-63005396 CAGCTAGTAAGTGAGTGAGCTGG + Intergenic
908520517 1:64936649-64936671 GAGCTAGTAAGTGGTGGAGCTGG - Intronic
908532944 1:65050833-65050855 CAGCTAGTCAGTGATGAAGCAGG - Intergenic
908783140 1:67709710-67709732 CTGTTAGTAAGTGCTGGTCTGGG - Intronic
908859880 1:68472014-68472036 TTGTAAGAAAGTGATGGAGGTGG - Intergenic
909475953 1:76081134-76081156 TGGTCAGTAAGTGATGGAGGTGG + Intronic
909522340 1:76584175-76584197 TAGTTAGTAAATGGTGGAGCTGG + Intronic
910127433 1:83859729-83859751 CCATTAGTAAGTGGTGCAGCTGG + Intergenic
910228599 1:84963099-84963121 CAGTTAGTAAGTGACAGAACTGG - Intronic
910333976 1:86107203-86107225 CTGTTTGTAAGTGGTAGAGGGGG - Intronic
910341444 1:86192985-86193007 CTGTTCATAAGTTAGGGAGCTGG - Intergenic
910425152 1:87114197-87114219 CAGCTAGAAAGTGGTGGAGCAGG + Intronic
910572342 1:88719974-88719996 CAAGTAGTAAGTGATAGAGCTGG + Intronic
910630793 1:89351920-89351942 CAGTTAGGAAATGATGGAGATGG - Intergenic
910730829 1:90394033-90394055 CAGCTAGGAAGTGATAGAGCTGG - Intergenic
910800585 1:91141445-91141467 CAGTTAGTAAGGGGTGGAGCTGG + Intergenic
910976537 1:92912280-92912302 GTGTTAGTAAGTGCTGGGGATGG - Intronic
910988487 1:93029852-93029874 ATGGTAGTAAATAATGGAGCTGG - Intergenic
911476988 1:98385933-98385955 CAGCTAGCAAGTGGTGGAGCTGG - Intergenic
911690764 1:100831546-100831568 CAGCTAGTAGGTGATTGAGCTGG - Intergenic
911709638 1:101055182-101055204 CAGTCAGTAAGTAGTGGAGCTGG + Intergenic
912230415 1:107786389-107786411 TTGCTAGTAAGAGATGGAGCTGG - Intronic
912347979 1:108982677-108982699 ATTTTAATAAGTGCTGGAGCAGG - Exonic
912371919 1:109180275-109180297 CTGCTACTAATTGGTGGAGCAGG - Intronic
912891965 1:113542887-113542909 CTGCTAGTAAGTGACAGACCTGG - Intronic
914319838 1:146548582-146548604 GAGCTAGTAAGTGATAGAGCTGG + Intergenic
914449123 1:147774976-147774998 CAGCTAGTAAGTGGCGGAGCCGG - Intergenic
914931289 1:151936076-151936098 CAACTAGTAAGTTATGGAGCAGG + Intergenic
915546309 1:156600485-156600507 TGGCTAGTAAATGATGGAGCTGG + Intronic
915656978 1:157368765-157368787 CAGTTAGAAAGTGACAGAGCTGG - Intergenic
915696396 1:157747088-157747110 TTGTTAGTAAGTGCTGGTGGAGG - Intronic
916300115 1:163264280-163264302 AAGTTAGTAAGTGACAGAGCTGG - Intronic
916325603 1:163556411-163556433 CTGTGATTAAGGGAAGGAGCAGG - Intergenic
916335303 1:163664518-163664540 TTGGTAGTAACTGATGGAACTGG - Intergenic
917828776 1:178854497-178854519 CTGTTAGTAAGTGTTGTTGGGGG - Intronic
917838131 1:178956889-178956911 TGGGTAGTAAGTGATAGAGCTGG - Intergenic
917958889 1:180126932-180126954 CAGCTAGTAAGTGGTGGAGCTGG + Intergenic
917959063 1:180128227-180128249 CAGTTAATAAGTGGTGGAACTGG + Intergenic
918141738 1:181725679-181725701 GTGTCTGGAAGTGATGGAGCAGG - Intronic
918529076 1:185497409-185497431 CAGTTAGTAAGTGGTAGACCTGG + Intergenic
920270341 1:204758213-204758235 TTTTTAGTAAGTGATAGAACTGG - Intergenic
921635016 1:217482093-217482115 CAGTTAGTAAGTGATTAAACTGG + Intronic
922137262 1:222841455-222841477 CTGCTAGTAAGTGTCAGAGCTGG + Intergenic
922431488 1:225559468-225559490 CTGTTAGTAACTGATGGAACAGG - Intronic
924701691 1:246460297-246460319 CTGTTACTAAGTGCTAGAGCAGG - Intronic
1063680596 10:8183942-8183964 CAGCTAGTTATTGATGGAGCTGG - Intergenic
1064388739 10:14922740-14922762 CTGTTAGTAAGTGGCGGAGCTGG + Intronic
1064577227 10:16758521-16758543 CAGCTAGCAAGTGCTGGAGCCGG - Intronic
1064750405 10:18522577-18522599 TTTTTAGTAAGTGATCAAGCAGG + Intronic
1064826699 10:19411589-19411611 ATGTTAGTAAGTGGTTGAGCTGG + Intronic
1065035251 10:21631372-21631394 CTATTAATAAATGATAGAGCTGG + Intronic
1065869212 10:29941675-29941697 GTGTTGCTAAGTGATGGGGCTGG - Intergenic
1066014414 10:31225234-31225256 CTGTTAAAAACTGATGGAACAGG - Intergenic
1067716885 10:48696948-48696970 AGGTTAGGAAGAGATGGAGCTGG + Intronic
1068246072 10:54370548-54370570 CAGTTAGTAGGTTATGGAACTGG - Intronic
1068675377 10:59764457-59764479 CTGCTAGTAAGTGATGAAGCAGG - Intergenic
1070777972 10:79121111-79121133 CTGCTCATAAGTGTTGGAGCTGG + Intronic
1070779764 10:79130661-79130683 CGGTTAGTCAGTGATGGAGCCGG - Intronic
1071299686 10:84247260-84247282 CAGCTAGTAAGCGGTGGAGCTGG - Intronic
1071430191 10:85601197-85601219 CTGTTAGTAAGAGTTGGGGGAGG - Exonic
1072237373 10:93465181-93465203 CAGCTAGTAAGTGATGGAGCTGG + Intronic
1072762110 10:98065219-98065241 CAACTTGTAAGTGATGGAGCTGG - Intergenic
1073009025 10:100346120-100346142 CAACCAGTAAGTGATGGAGCTGG - Intergenic
1073052772 10:100679617-100679639 CAGTTAGTAAGGGATGGCACTGG - Intergenic
1073222770 10:101890003-101890025 ATGTGACTAAGTGATGGAGAAGG - Intronic
1073433236 10:103500393-103500415 CAGTTAGAAACTGATGGGGCTGG + Intronic
1073728712 10:106266587-106266609 TTGATAGTAAGTGATGGAGCCGG + Intergenic
1074286065 10:112099397-112099419 GAGCTAGTAAGTGATGGAACCGG + Intergenic
1074828906 10:117234967-117234989 CTGTTATTAAGGGATGGGGGTGG - Intergenic
1074881855 10:117665792-117665814 CAGCTAATAAGTAATGGAGCTGG + Intergenic
1076283926 10:129275224-129275246 CTGCAGGTAAGGGATGGAGCGGG - Intergenic
1076510094 10:131007206-131007228 CAGCTAGTATGTGACGGAGCTGG + Intergenic
1077848683 11:6053002-6053024 CAGCTAGGAAGTGATGGTGCTGG - Intergenic
1077957570 11:7037502-7037524 GAGCTAGTAAGTGATGCAGCTGG - Intronic
1078016569 11:7620106-7620128 TAGCTAGTAAGTGGTGGAGCTGG - Intronic
1078117666 11:8470050-8470072 CTGTTAGTGACTAATGAAGCTGG - Intronic
1078410545 11:11112895-11112917 TAGCTAGTAAGTGATGGAGCTGG + Intergenic
1078425103 11:11243501-11243523 CTGGCAGTAAGTGGTGGAGCAGG - Intergenic
1078510132 11:11978931-11978953 CAGCTAGTGAGTGCTGGAGCTGG + Intronic
1079284159 11:19114442-19114464 CAGATACTAAGTGCTGGAGCTGG + Intergenic
1080118589 11:28648230-28648252 CTGTTTGTAGGAGATGAAGCTGG + Intergenic
1080261180 11:30351372-30351394 TAGCTAGTAAGTGATGGAGCCGG - Intergenic
1080320758 11:31006526-31006548 CTGCTAGTAAGTGGCAGAGCAGG - Intronic
1081662437 11:44896307-44896329 CTGTTGGTAAGTGATGGGGCTGG - Intronic
1082847212 11:57736030-57736052 ATGTTGGTAAGTGAAGGAGGGGG + Intronic
1082911715 11:58384471-58384493 CTGTTTGTAGGTAATGGGGCTGG - Intergenic
1083140857 11:60720364-60720386 CTGCTAGTAAATGATAGAGCTGG + Intergenic
1083826315 11:65205905-65205927 CAGGTAGTCAGTGAGGGAGCTGG + Intronic
1083870390 11:65484195-65484217 GAGTTAGTAACTGTTGGAGCTGG + Intergenic
1084367667 11:68713239-68713261 TTGTTAGTGAGTTAGGGAGCTGG + Intronic
1085187355 11:74587713-74587735 CTGCTAGTAAGTGGTAAAGCTGG + Intronic
1085353688 11:75816617-75816639 CAGTTAGTAAGTGGTGGGGCTGG + Intronic
1085521909 11:77144065-77144087 CAGCTAGTAAGTGATGGTGCTGG + Intronic
1085569421 11:77546396-77546418 CAGCCAGGAAGTGATGGAGCTGG - Intronic
1085746971 11:79123352-79123374 TAGCTAGGAAGTGATGGAGCTGG + Intronic
1085767873 11:79299323-79299345 CAGCTAGTAACTGAAGGAGCCGG + Intronic
1085857590 11:80193028-80193050 CAGCTACTAAGTGCTGGAGCTGG - Intergenic
1086265716 11:84995320-84995342 ATCTTAGTAAGTGGTGGAGCTGG - Intronic
1086269273 11:85040950-85040972 CAGTTAGTAATAGGTGGAGCTGG + Intronic
1086402041 11:86468971-86468993 CACTTGGTAAGTGGTGGAGCTGG + Intronic
1086487275 11:87320275-87320297 CAGTTAGTAAATGAAGGAGCTGG + Intronic
1086835104 11:91611110-91611132 CAGTTAATAAGTAATGGAGCTGG + Intergenic
1087025698 11:93647368-93647390 TAGCTAGTAAGTGATGGAGTTGG - Intergenic
1087437001 11:98133193-98133215 CTGCTAGTAAGTGGTAGAGTAGG - Intergenic
1087833050 11:102840486-102840508 CTGTGAGTGAGTGATAGAGTGGG + Exonic
1087896269 11:103590015-103590037 ATTTTATTGAGTGATGGAGCTGG - Intergenic
1087934202 11:104013227-104013249 GTTTTATTGAGTGATGGAGCTGG - Intronic
1088042568 11:105405453-105405475 GTGCTAATAAGTGGTGGAGCGGG - Intergenic
1088090189 11:106029204-106029226 CAGTTAGTAAGTGGCAGAGCTGG + Intergenic
1088454765 11:110022089-110022111 CAGTGAGCAAGTGTTGGAGCTGG + Intergenic
1089375991 11:117995229-117995251 CAGCTAGTAAGTGGTGAAGCTGG + Intronic
1089396533 11:118139670-118139692 CAGCTAGTAAGTGATAGAGCTGG - Intronic
1089531418 11:119132292-119132314 CAGCTAGTAAGTGGTGAAGCTGG + Intronic
1089788691 11:120926555-120926577 CAGTTAGTAAGTGGCTGAGCTGG + Intronic
1089821553 11:121231877-121231899 AGGCTAGTAAGTGGTGGAGCTGG - Intergenic
1090198463 11:124837553-124837575 CTCTTTGTCACTGATGGAGCGGG - Intergenic
1090620563 11:128557140-128557162 ATGTTGGTAAGTGATAGAGCTGG - Intronic
1090745905 11:129704640-129704662 CTGTTACTTCATGATGGAGCTGG - Intergenic
1091202692 11:133794260-133794282 CTGTTGGTAAGTGAAGGATCAGG - Intergenic
1091403143 12:193043-193065 CTGTGAGGAAGGGATGGAGCCGG + Intronic
1091446694 12:547853-547875 CTGTTAGCAAGTGATAGAGTGGG + Intronic
1091913563 12:4251129-4251151 CAGCTAGTAAGTGACAGAGCTGG - Intergenic
1092901108 12:13060153-13060175 CTGCTGGTAAATGATAGAGCTGG + Intronic
1094190041 12:27688809-27688831 AAGTTAGTGAGTGATAGAGCTGG - Intronic
1095500251 12:42829857-42829879 CTGCTAGTAAGTGGTGAAGCAGG + Intergenic
1095772779 12:45980519-45980541 CACCTAGCAAGTGATGGAGCTGG + Intronic
1095947330 12:47760766-47760788 CAGCTAGTAAATGGTGGAGCTGG + Intronic
1096813194 12:54184592-54184614 CAGTTAGTAAGTAATAAAGCTGG + Intronic
1097294873 12:57951368-57951390 GAGTTAGTAAGGGGTGGAGCTGG + Intronic
1097440236 12:59599007-59599029 CAGTTAGTAAGTGGTTGAGCTGG + Intronic
1098161937 12:67654116-67654138 CATTTAGTAAATGGTGGAGCTGG + Intronic
1098205454 12:68104561-68104583 CAGCTAGGAAGTGGTGGAGCTGG + Intergenic
1098389666 12:69956220-69956242 CAGGTAGTAAGTGATGGAGCTGG + Intronic
1098477770 12:70925159-70925181 CAGTTGGTAAGTGGTGAAGCTGG + Intergenic
1098874365 12:75851530-75851552 TAGCTACTAAGTGATGGAGCTGG + Intergenic
1099090696 12:78303941-78303963 TAGATAGTAAGTGATGAAGCTGG - Intergenic
1099146716 12:79055050-79055072 TAGTTAATAAGTGGTGGAGCTGG - Intronic
1099951070 12:89304305-89304327 CAGTTAGTAAGGGGTGGAGGTGG - Intergenic
1100219892 12:92493456-92493478 CTGTTAGTAAGTGTCTGTGCAGG + Intergenic
1100610145 12:96185168-96185190 CGGTTAACAAGTGATGGAGTTGG - Intergenic
1101241117 12:102841145-102841167 CTGTCAGTAAGTTATGCAGCTGG + Intronic
1101304152 12:103510897-103510919 CTCTTAGTAGATGATGGGGCTGG - Intergenic
1101435271 12:104658919-104658941 CTGCTAGTAAGTGGTGAAGCTGG + Intronic
1101753191 12:107600216-107600238 CAGCTTGTAGGTGATGGAGCTGG - Intronic
1101764446 12:107685136-107685158 CTGCTAGTAAGCGGTGCAGCTGG - Intergenic
1101822447 12:108194483-108194505 CAGCTGGTGAGTGATGGAGCTGG - Intronic
1101839744 12:108319472-108319494 CAGGTAGTAAGTGACAGAGCTGG - Intronic
1102090298 12:110181678-110181700 CTCTCAGTAACTGATGGAACAGG - Intronic
1102327649 12:112001944-112001966 CAGCTAGTAAGTGTTGGAGCTGG - Intronic
1102485051 12:113249865-113249887 CATTTAGAAAGTGACGGAGCTGG - Intronic
1102963822 12:117111495-117111517 GTGCTAGTAAGTGACAGAGCTGG + Intergenic
1103050993 12:117779357-117779379 CAGCTAGTAAGTAGTGGAGCTGG - Intronic
1103389530 12:120561685-120561707 TTGCTAGTAAGGGATGCAGCTGG + Intronic
1103863706 12:124034613-124034635 ATTTAAGTAAGTGATGGATCTGG + Intronic
1104161846 12:126188876-126188898 CTGCTAGTACGTGGTGGAGCTGG - Intergenic
1104263449 12:127206944-127206966 CAGCTAGTAAGTGACAGAGCTGG + Intergenic
1105893320 13:24697698-24697720 ATTTTAGAAAGTGATAGAGCTGG + Intronic
1106151246 13:27105030-27105052 GAGTTAGTAAGTGGTGGAGCTGG - Intronic
1106407877 13:29489451-29489473 CTATTAGTAAGTGACCAAGCTGG + Intronic
1106702453 13:32244846-32244868 CAGTTAGTAAAGGCTGGAGCTGG + Intronic
1107205788 13:37785984-37786006 CTGTAATTAAGAGATGGAGGAGG + Intronic
1107734500 13:43384028-43384050 CTGTTAGTGAGTGGTGCAGCCGG - Intronic
1108068750 13:46605997-46606019 CAGTAAGTGAGTGATGAAGCTGG + Intronic
1108404272 13:50083846-50083868 CAGCTAGTAAGTAGTGGAGCTGG - Intronic
1109862574 13:68219638-68219660 CAGTTAGCAAGTGATAGAGCTGG + Intergenic
1109941813 13:69377211-69377233 ATTTTATTAAGTGATGGAGGTGG + Intergenic
1110072244 13:71191696-71191718 ATTTTATTAAGTGATGGAGGTGG + Intergenic
1110797827 13:79660310-79660332 ATGTTAGAAAGTGTGGGAGCAGG + Intergenic
1111688251 13:91527882-91527904 CTTTTAGTAACAGCTGGAGCTGG + Intronic
1112383960 13:98920489-98920511 CAGTTGGTAAGTGGAGGAGCAGG + Intronic
1112678724 13:101736799-101736821 CAGTTAGTAAGTGGCGAAGCAGG + Intronic
1113340888 13:109424704-109424726 CAGCTAGTAAATGATGGAGCTGG + Intergenic
1113921406 13:113915055-113915077 CTGCTTGCAAGTGATGGGGCCGG + Intergenic
1114038270 14:18650067-18650089 TTGCCAGTAAGTGGTGGAGCTGG - Intergenic
1114120351 14:19664975-19664997 TTGCCAGTAAGTGGTGGAGCTGG + Intergenic
1115306045 14:31934764-31934786 CAATTAGTAAGTGGTAGAGCTGG + Intergenic
1116780301 14:49229497-49229519 CAGTAAGTAAGTGCTAGAGCAGG - Intergenic
1117296876 14:54388542-54388564 CAGTTAGTAAGGGGTGGAGCTGG - Intergenic
1117755393 14:58969550-58969572 CTGTTAATAGGTGGTGGTGCTGG + Intergenic
1117894718 14:60471429-60471451 CATTTAGTAAGTGATGGAAAGGG + Exonic
1117895335 14:60479217-60479239 CTGTTACTAAGTGATAAAGGAGG - Intronic
1119428977 14:74553441-74553463 CAGCTAGCAAGTGATGCAGCTGG + Intronic
1119490884 14:75031913-75031935 CAGTTATTAAGTAGTGGAGCAGG - Intronic
1119494348 14:75065842-75065864 CAACCAGTAAGTGATGGAGCTGG + Intronic
1119566327 14:75632190-75632212 CAGGTATTAAGTGATGGAGCTGG - Intronic
1119829829 14:77692258-77692280 CAGCTATTAAGTGGTGGAGCTGG + Intronic
1120157691 14:81112145-81112167 CAGTTAGTAAGTGATGGGGCTGG - Intronic
1120290920 14:82569773-82569795 CTTTGAGGAAGTGATGGAGTAGG - Intergenic
1120706304 14:87749728-87749750 CTGTTGCTAAGTGGTAGAGCTGG - Intergenic
1120788198 14:88555531-88555553 CAGCTAGTAAATGTTGGAGCTGG - Intergenic
1120856885 14:89220271-89220293 CTGCTGGTAAGTACTGGAGCCGG - Intronic
1122317635 14:100835366-100835388 CTGCTAGAGAGTGAAGGAGCTGG - Intergenic
1124018357 15:25897767-25897789 CAGTAAGTAAGTAATGGAGGTGG + Intergenic
1125732402 15:41900574-41900596 CGGTGAGTCAGTGGTGGAGCAGG + Exonic
1125790749 15:42363861-42363883 CAGTTAGTGAGGGTTGGAGCTGG + Intronic
1127016773 15:54697692-54697714 AATTTAGTAAGTGATTGAGCTGG - Intergenic
1127383038 15:58445689-58445711 GTGCTGGGAAGTGATGGAGCTGG - Intronic
1127551856 15:60046253-60046275 CAGTTAATCAGTGAAGGAGCTGG - Intronic
1127689655 15:61382879-61382901 CTTTAGGTAAGTGATGAAGCAGG - Intergenic
1127762670 15:62154268-62154290 CAGGTAGTAAGTGAAGGAGCTGG - Intergenic
1128264721 15:66255718-66255740 CAGTTAGTAAGTGGTGGAGCAGG - Intergenic
1129763573 15:78146897-78146919 CAGCTAGTAAGTGATGATGCTGG - Intronic
1129906153 15:79188758-79188780 TAGCTAGTAAGTGCTGGAGCTGG + Intergenic
1129993447 15:79984514-79984536 ATGGCAGTAAGTGATGGAGCTGG + Intergenic
1130007795 15:80117973-80117995 GACTTAATAAGTGATGGAGCTGG + Intronic
1130127226 15:81104098-81104120 GAGCTAATAAGTGATGGAGCTGG + Intronic
1130169298 15:81495258-81495280 CTGCGAGTAAGTGGTAGAGCTGG - Intergenic
1130179846 15:81614245-81614267 CAGCTAGTAGGTGATGAAGCTGG + Intergenic
1130222871 15:82035957-82035979 CAGTTAGTAAGTGTCAGAGCTGG + Intergenic
1130748784 15:86686907-86686929 CAGCTAGTAAGTGATGAAGCTGG + Intronic
1130769966 15:86914430-86914452 CGTTTAGTAAATGATAGAGCTGG + Intronic
1130808937 15:87356598-87356620 CTGGAAGAAAGTGATGAAGCAGG - Intergenic
1130909957 15:88264120-88264142 CAGCTAGAAAGTGCTGGAGCTGG - Intergenic
1130964587 15:88687404-88687426 CAGCTAGTAAGTGATGGAGCTGG - Intergenic
1131953788 15:97709887-97709909 CAGCTAGTAAGAGGTGGAGCTGG + Intergenic
1131961327 15:97792871-97792893 CAGGAAGTCAGTGATGGAGCGGG - Intergenic
1132035909 15:98484494-98484516 CAGCCAGTAAGTGATGTAGCTGG + Intronic
1132136388 15:99344308-99344330 CAGTTAGTAAGTGAGGAAGCAGG + Intronic
1133368500 16:5229854-5229876 CAGCTAGTAAAGGATGGAGCTGG - Intergenic
1133465984 16:6027469-6027491 GACTTAGAAAGTGATGGAGCTGG - Intronic
1134109720 16:11507458-11507480 CTGCTAGCAAGTGATAGAGCTGG - Intronic
1134385306 16:13766404-13766426 CTCTTAGAAAGTGATTGAGCTGG + Intergenic
1135064938 16:19301468-19301490 CAGGTAGGAAGTGATGGAGCTGG - Intronic
1135142726 16:19935561-19935583 CAGCTAGCAGGTGATGGAGCTGG + Intergenic
1135184096 16:20299857-20299879 ATGCTAGTAAGTGAATGAGCTGG + Intergenic
1135660042 16:24288387-24288409 CAGTTAGTAAGTATTGGACCTGG + Intronic
1135832152 16:25784946-25784968 TTGTTAGGAAGTAATGCAGCTGG + Intronic
1135851107 16:25964592-25964614 CAGCTAGGAAATGATGGAGCTGG + Intronic
1135936799 16:26787391-26787413 CAGCTAGTACATGATGGAGCAGG - Intergenic
1136082779 16:27863590-27863612 CATTTAGTAAGTGCTGGAGTTGG - Intronic
1136122966 16:28152398-28152420 CAGTTAGTAAGTGGTGGAGCTGG - Intronic
1136402663 16:30027015-30027037 CAGCTAGTAAGAGATGGTGCTGG + Intronic
1137586526 16:49667114-49667136 GAGTTAGTAAGTGGTGGAGTTGG - Intronic
1137804766 16:51294512-51294534 CTGTGAGGAAGTAATGGAGCTGG - Intergenic
1137995931 16:53212755-53212777 CTGCTTGTAAGTGATGAAACTGG - Intronic
1138103872 16:54276487-54276509 CAGTTAGAGAGTGATGGAGCTGG + Intergenic
1138436058 16:57000723-57000745 CTGTGAGTCAGTGATGATGCAGG - Intronic
1138491374 16:57378945-57378967 CAGCCAGCAAGTGATGGAGCAGG - Intronic
1138744170 16:59344036-59344058 CAGTTAGTAAATGGTGAAGCAGG - Intergenic
1139489307 16:67278199-67278221 CTGGGAGTTAGGGATGGAGCAGG + Exonic
1140013689 16:71161495-71161517 GAGCTAGTAAGTGATAGAGCTGG - Intronic
1140326589 16:74010070-74010092 CAGCTAGTAAGTGTTGGACCTGG + Intergenic
1140681492 16:77389523-77389545 CTGCGAATAAGTAATGGAGCAGG + Intronic
1140879722 16:79187140-79187162 CAATTCGTAAGTGGTGGAGCTGG - Intronic
1140962169 16:79926641-79926663 CAGCTAGTAAGTGACAGAGCTGG + Intergenic
1141521689 16:84584408-84584430 CAGTTAATGAGTGATAGAGCTGG - Intronic
1141771081 16:86089993-86090015 CAGCTAGGAAGAGATGGAGCTGG + Intergenic
1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG + Intronic
1142864633 17:2783112-2783134 CAGCTAGTAAGTGATGGAGCCGG + Intronic
1142897739 17:2992838-2992860 GAGCTAATAAGTGATGGAGCGGG - Intronic
1143215444 17:5221439-5221461 CAGTTAATAAATGATAGAGCCGG + Intronic
1143351164 17:6289240-6289262 GGGGTGGTAAGTGATGGAGCAGG + Intergenic
1143375653 17:6465575-6465597 TTGTTGCTAAGTGGTGGAGCAGG - Intronic
1144477349 17:15599833-15599855 CAGCTAGTAAGTGATGGCCCTGG - Intronic
1144920891 17:18763536-18763558 CAGCTAGTAAGTGATGGCCCTGG + Intronic
1145771023 17:27493259-27493281 CAGTTAGTAAATGCTGAAGCTGG + Intronic
1145915219 17:28569734-28569756 CAGCTAGTAAGAGATGGAACTGG - Intronic
1146026115 17:29322686-29322708 CTGATAATAAGTGATAGAGATGG + Intergenic
1146087237 17:29840888-29840910 CAGTCAGTAAGTGGTGAAGCTGG + Intronic
1146202088 17:30867491-30867513 CAGCTAGAAAGTGATGGAACTGG + Intronic
1146226038 17:31066973-31066995 CTGTTAGTAAGTGGCCAAGCTGG + Intergenic
1146376810 17:32300133-32300155 CAGCTAGAAAGTGGTGGAGCTGG + Intronic
1147550991 17:41441315-41441337 CTGTTGGTCAGTGGTGTAGCAGG + Intergenic
1149343657 17:55713061-55713083 CAGGTAGTAAGTGATAAAGCTGG + Intergenic
1149966130 17:61165927-61165949 TAGTTACTAAGTGATAGAGCTGG + Intronic
1151148428 17:72063464-72063486 CTGCTTGTAAGTGGTGAAGCTGG + Intergenic
1151328016 17:73390772-73390794 CTGCTGGTAAGTGACAGAGCTGG + Intronic
1151357492 17:73569129-73569151 CTAGTAGTAAGAGATAGAGCTGG + Intronic
1151804967 17:76399562-76399584 CTGGGAGGAAGTGGTGGAGCTGG + Exonic
1152511269 17:80790627-80790649 CTGGAAGTGAGTGATGGAGAAGG - Intronic
1152982452 18:291237-291259 CTGGTGGTAAGTGAGGAAGCTGG + Intergenic
1153011546 18:544267-544289 CAGCTAGCAAGTGGTGGAGCAGG - Intergenic
1153344773 18:4013381-4013403 CAGTTAGTAAGTGAAGGAGCTGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153571499 18:6477778-6477800 CACATAGTAAGTGCTGGAGCTGG + Intergenic
1155026196 18:21943061-21943083 CTGCTAGTAAGTGATGGAGCCGG - Intergenic
1155853140 18:30797485-30797507 CAGCTAGTAAATGGTGGAGCTGG - Intergenic
1155986770 18:32238430-32238452 CAGCTAGTAAGTGCTGGAGCTGG + Intronic
1156004791 18:32427401-32427423 CTGTTAATAAATGACAGAGCTGG + Intronic
1156283575 18:35667042-35667064 CTGTTAGGAATTGTTGAAGCTGG - Intronic
1156512976 18:37656827-37656849 TCATTAGTAAGTGGTGGAGCAGG - Intergenic
1157169940 18:45393931-45393953 TCATTAGTAAGTGATGGAGATGG + Intronic
1157204213 18:45684934-45684956 CTCTCAGGAACTGATGGAGCCGG - Intergenic
1157564375 18:48670044-48670066 CAGTTGGTAAGGGATGCAGCGGG + Intronic
1158188285 18:54796458-54796480 CTTTTATTGAGTGATGGAGGTGG + Intronic
1158326376 18:56317905-56317927 CAGATAGTAAGTGATAGACCCGG + Intergenic
1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG + Intergenic
1158913777 18:62097986-62098008 CAGTTAGTAAGTGATTCAGCCGG - Intronic
1160146449 18:76369478-76369500 CTGCTAATTAGTGATTGAGCTGG - Intronic
1160242599 18:77133697-77133719 TTGTTAGGAAGTGAGGGAGAGGG + Intergenic
1160314577 18:77829940-77829962 CTTTTAGCATGGGATGGAGCAGG + Intergenic
1162305619 19:9871611-9871633 CTGCCTGTAAGTGATGTAGCTGG + Intronic
1162853784 19:13452498-13452520 CAGCAAGTAAGTGATGGAACTGG - Intronic
1165209471 19:34222209-34222231 TAGCTAGTAAGTGATGGTGCTGG + Intronic
1165410388 19:35656915-35656937 CAGCTAGGAAGTGATGGAGCAGG + Intronic
1166148282 19:40851954-40851976 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166152425 19:40883739-40883761 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166177756 19:41086906-41086928 CAGGGAGTAAGTGAGGGAGCTGG - Intergenic
1166633723 19:44431017-44431039 CTGTGAGGCAGTGGTGGAGCTGG + Intronic
1166658264 19:44627795-44627817 CTGCTAGTAAGTTACAGAGCTGG - Intronic
1166738563 19:45100555-45100577 CAGTGGGTAAGTGGTGGAGCTGG + Intronic
1167139644 19:47640839-47640861 CAGCCAGTAAGTGGTGGAGCTGG + Intronic
926015059 2:9443968-9443990 TAGTAAGTAAGAGATGGAGCTGG - Intronic
926072529 2:9909838-9909860 GAGCTAGTAAGTGATGGAGCAGG + Intronic
926695769 2:15769479-15769501 CAGGAAGTAAGTGTTGGAGCTGG + Intergenic
926739174 2:16096956-16096978 GTGTCAGCAACTGATGGAGCTGG + Intergenic
926769999 2:16362708-16362730 CAGGTAGTAAGTGATAGAGGAGG + Intergenic
927010732 2:18901067-18901089 CTGTTGAAAAGTGATAGAGCTGG - Intergenic
927097272 2:19757140-19757162 TTGTGAGGAAGTGATGGAGCAGG + Intergenic
927138280 2:20113132-20113154 CAGCTAGTAAGTGATAGATCAGG - Intergenic
928074102 2:28247282-28247304 CTGTGAGTTAGTGAGGGAGCAGG - Intronic
929411137 2:41698407-41698429 CAGCTAGTGAGTGATAGAGCAGG + Intergenic
929745072 2:44648647-44648669 AGGTTAGTAAGTGATGGTGAAGG - Intronic
929852096 2:45601490-45601512 CAGATAGTAAGTGATGGAACTGG - Intronic
929927916 2:46230661-46230683 CAGTTAGTCAGGGATGAAGCTGG + Intergenic
929930618 2:46252899-46252921 CAGCTAGTAAGTGCTGGATCTGG + Intergenic
931762176 2:65427884-65427906 CTGTGAGTAACTGAAGGAGCTGG - Intronic
932129470 2:69174951-69174973 CAGTTATTAAGTGATGGGACTGG + Intronic
932596289 2:73095671-73095693 CAGCTAGTAAGTAATGGAGCTGG + Intronic
932709323 2:74050198-74050220 CAGCTAGTAAGTGATGGAGTTGG - Intronic
932761777 2:74442455-74442477 CGGTTAGTTAGTGACAGAGCTGG - Intergenic
933551895 2:83788450-83788472 CTGATAGTCATTAATGGAGCAGG - Intergenic
933707276 2:85301266-85301288 CGGTTAGTAAGTGGCAGAGCTGG - Intronic
934059437 2:88280457-88280479 CGGCTAATAAGTGCTGGAGCTGG - Intergenic
935352478 2:102164576-102164598 CAGGCAGTAAGTGATGCAGCTGG + Intronic
935408300 2:102732945-102732967 TGTTTAGTAAGTGATGGAGGTGG - Intronic
935699832 2:105801868-105801890 CTGAGAGAAAGTGATGGAGCTGG + Intronic
935817758 2:106863236-106863258 CTGTCATTAAGTGATGGAAAGGG + Intronic
936538081 2:113327249-113327271 GAGTTAGTTATTGATGGAGCAGG - Intergenic
936923858 2:117716677-117716699 CTGTCAGTAAGTGGTAGATCTGG - Intergenic
937250535 2:120521100-120521122 CAGGTAGTAAGTGGTGGAGCCGG + Intergenic
937667693 2:124505305-124505327 ACGTTCCTAAGTGATGGAGCTGG + Intronic
938247097 2:129786214-129786236 CTGCCAGTAAGTGCTAGAGCTGG + Intergenic
938272690 2:129989033-129989055 TTGCCAGTAAGTGATGGAGCTGG + Intergenic
938277568 2:130039876-130039898 TTGCCAGTAAGTGGTGGAGCTGG + Intergenic
938328533 2:130430679-130430701 TTGCCAGTAAGTGGTGGAGCTGG + Intergenic
938361413 2:130690815-130690837 TTGCCAGTAAGTGGTGGAGCTGG - Intergenic
938437818 2:131297505-131297527 TTGCCAGTAAGTGGTGGAGCTGG - Intronic
938927159 2:136054679-136054701 CAGCTAGTAAGTGGTAGAGCTGG + Intergenic
939338747 2:140865991-140866013 CAGTTAGTAAATGAAGGAGAAGG + Intronic
939490983 2:142875941-142875963 ATCATAGTTAGTGATGGAGCGGG + Intergenic
939968619 2:148635892-148635914 AGGTCAGTAAGTGATGGACCTGG + Intergenic
940976226 2:159948125-159948147 CAGCTAGTAAGTGGTGGAGCCGG - Intronic
941525202 2:166598151-166598173 CTTTTAGTCATTGCTGGAGCTGG + Intergenic
941579907 2:167282898-167282920 CAGCTAATAGGTGATGGAGCTGG + Intergenic
941992546 2:171571068-171571090 CAATTAGTAAGTGATAAAGCTGG - Intergenic
942207886 2:173640391-173640413 CATCTAGTAAGTGGTGGAGCTGG - Intergenic
942370998 2:175284566-175284588 CAGCTGGTAATTGATGGAGCTGG - Intergenic
942469635 2:176246279-176246301 CAGCTAGTAAGTGATGGAGCTGG + Intergenic
942633910 2:177981057-177981079 CAGCTATTAAGTGAAGGAGCTGG - Intronic
942738511 2:179145323-179145345 CAGCTAGTAAATGCTGGAGCTGG - Intronic
943192686 2:184699890-184699912 CAGTTACTAAGTAGTGGAGCTGG + Intronic
944043864 2:195386740-195386762 CTGTTATTAATTACTGGAGCAGG - Intergenic
945324645 2:208468389-208468411 CCAATATTAAGTGATGGAGCCGG + Intronic
945581333 2:211598936-211598958 CAGCAAGTAAATGATGGAGCAGG - Intronic
945724049 2:213453319-213453341 GTGGTAGTAAGTGAGAGAGCTGG + Intronic
945922227 2:215766838-215766860 CTGTTAGTCAGACATGGAACAGG + Intergenic
945940872 2:215948709-215948731 CTGTTAGTAAATAACAGAGCTGG - Intronic
946152863 2:217787914-217787936 CTGTTAGTAAGTGCTGCATAAGG - Intergenic
947111092 2:226720565-226720587 CACTTAGTGAGGGATGGAGCTGG - Intergenic
947925124 2:233914621-233914643 CTGGTAGCAACTGATGGAGGTGG - Intergenic
948282107 2:236754729-236754751 CAGGTAGTAAGTGGAGGAGCTGG - Intergenic
948463207 2:238140069-238140091 CATTTAGGAAGTGGTGGAGCTGG - Intronic
1168787112 20:549267-549289 CTGCTAGTAAGTGACAGAGCTGG - Intergenic
1168816648 20:742327-742349 CAGCTGGTAAGTGATAGAGCTGG - Intergenic
1170099692 20:12685395-12685417 CTTCTAGCAAGAGATGGAGCAGG - Intergenic
1172019973 20:31907164-31907186 CAGTTAGTAAGTGGCAGAGCAGG - Intronic
1172242276 20:33421241-33421263 CAGTTAGACAGTGCTGGAGCTGG - Intronic
1172462041 20:35126550-35126572 CGGTTAGCAAGTGGTAGAGCTGG - Intronic
1172507150 20:35471795-35471817 AAGCTAGTAAGTGATAGAGCAGG + Intronic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1172884861 20:38224051-38224073 CAGCTTGTAAGTGATGGAGCTGG - Intronic
1173191294 20:40878033-40878055 ATGTTAGTAATTGTTGAAGCTGG + Intergenic
1173625300 20:44467895-44467917 ATGGCAGTAAGTGATGGAGGAGG - Intergenic
1173695449 20:45007226-45007248 TGGCTAGTAAGTGGTGGAGCTGG + Intronic
1173741276 20:45404236-45404258 CAGCTAGTAAGTGATGGACCTGG - Intronic
1174166070 20:48584400-48584422 CAGCTAGGAAGTGGTGGAGCTGG - Intergenic
1174675261 20:52347621-52347643 CAGCTAGTGAGTGGTGGAGCTGG + Intergenic
1175150871 20:56932924-56932946 CAGCTAGGAAGTGATGGAGCTGG + Intergenic
1176908795 21:14537280-14537302 CTGGAAGAAAGTGAAGGAGCTGG - Intronic
1176968804 21:15242292-15242314 CTGTTGGAAAATGATGCAGCTGG - Intergenic
1178413878 21:32388171-32388193 CAGCTAGTAAGTGACTGAGCGGG - Intronic
1178829931 21:36047609-36047631 TTCTTAGTCAGTGATGGATCGGG + Intronic
1178981717 21:37269999-37270021 CTGGTGGGAAGTGATGTAGCTGG - Intergenic
1178998299 21:37428102-37428124 CAGCTAGTAAGGGATGGAGCTGG + Intronic
1179253390 21:39693701-39693723 CTGTCAGTAATTGATAGAACAGG - Intergenic
1179462757 21:41548690-41548712 CACCTAGTAAATGATGGAGCAGG + Intergenic
1180462392 22:15577108-15577130 TTGCCAGTAAGTGGTGGAGCTGG - Intergenic
1182032459 22:27170233-27170255 TAGTTTGGAAGTGATGGAGCTGG + Intergenic
1182081001 22:27528702-27528724 CTGTGACTAAATGATGGGGCAGG + Intergenic
1182161655 22:28128492-28128514 CTGTCAGCAAATTATGGAGCAGG + Intronic
1182315987 22:29447670-29447692 GGGTTAGTAAGGGGTGGAGCAGG + Intergenic
1182327068 22:29521355-29521377 CTGCTAGTAAGTGCTAGAGGTGG + Intronic
1182520702 22:30883100-30883122 CTGGCAGGAAGTGATGGTGCAGG + Intronic
1183104456 22:35606337-35606359 CTGCTAGTAAGTGGCAGAGCTGG - Intergenic
1183257580 22:36772296-36772318 CAGCTAGAAAGTGATGGAGCTGG - Intronic
1183589131 22:38769798-38769820 CTGCCAGTAAGGGATGGAGCTGG - Intronic
1183603161 22:38851685-38851707 CTATTAGTAAGTTGTGCAGCTGG - Intergenic
1183667171 22:39252798-39252820 CTGTTGGTTAGAGGTGGAGCTGG + Intergenic
1183687366 22:39368824-39368846 CTGTTAGTAAGTGTTCGAGAGGG + Intronic
1183805243 22:40203847-40203869 CTGTTAGTCAGAGAGGGAGGAGG + Intronic
1183849791 22:40575708-40575730 CTGGTAGTAAGTGGTGGTGTTGG - Intronic
1184387379 22:44183802-44183824 CTCTTAGCAAGTGGTGGACCTGG + Intronic
1184595536 22:45511791-45511813 GTCTTAGTAAGGGAGGGAGCTGG + Intronic
1184804533 22:46784922-46784944 CAGCTAGTAAGTGTTGGAGCTGG + Intronic
1184873681 22:47258626-47258648 CTGGTGGTGAGTGATGGAGTAGG - Intergenic
1185156774 22:49197778-49197800 TTGTTAGGAAGAGCTGGAGCTGG - Intergenic
1185171737 22:49298311-49298333 CTGTTTATAAGTCAGGGAGCCGG + Intergenic
949416281 3:3818089-3818111 CTGTTAGTAAGTGTTGCATAAGG - Intronic
949573372 3:5314742-5314764 CAGCTAGTAAATGATGGAACTGG - Intergenic
949585559 3:5433450-5433472 CAGTGAGTAAGTGTTGAAGCTGG + Intergenic
949714872 3:6918475-6918497 CAACTAGTAAGTGATGGAGCTGG - Intronic
949861030 3:8504925-8504947 CAGCTAGTAAGTGGGGGAGCTGG - Intronic
949894877 3:8761566-8761588 TGCTGAGTAAGTGATGGAGCTGG - Intronic
950013259 3:9738751-9738773 TTGTGAGAAAGTGGTGGAGCTGG - Intronic
950061324 3:10073877-10073899 CAGTTAATAAATGCTGGAGCTGG + Intronic
950104066 3:10377295-10377317 CTGTCAGACAGGGATGGAGCCGG - Intronic
950127990 3:10522352-10522374 CAGCTAGTAAGTGGAGGAGCTGG + Intronic
950222264 3:11205410-11205432 CAGCTAGTGAGTGGTGGAGCTGG - Intronic
950302381 3:11892096-11892118 CAGTTAATAAATGCTGGAGCTGG + Intergenic
950638649 3:14333688-14333710 CAGCTGGTAAGTGGTGGAGCTGG - Intergenic
950923693 3:16719199-16719221 AAGCTAGTCAGTGATGGAGCAGG - Intergenic
950939201 3:16876428-16876450 CTTGGAGGAAGTGATGGAGCTGG - Intronic
951104072 3:18722588-18722610 TAGTTAGGAAGTTATGGAGCTGG - Intergenic
951840534 3:27029058-27029080 CAGCTAGTAAGTGACAGAGCTGG - Intergenic
952404393 3:32992614-32992636 CTGATGGAAAGTGATGGAGCAGG + Intergenic
952441427 3:33333899-33333921 TTGTTAGTAAGTGATATAGAAGG - Intronic
952539738 3:34355293-34355315 CTGCTAGTTTGTGATGGAGATGG - Intergenic
953200503 3:40774182-40774204 CAGTTAGAAAGTGATGGTGTTGG + Intergenic
953483501 3:43272951-43272973 CTGTTAATAATGGATGGATCAGG - Intergenic
953507572 3:43501269-43501291 CTGTTAGTTCCTGCTGGAGCTGG - Intronic
955459784 3:59169326-59169348 TTGTTAGGAAGTTATGAAGCTGG + Intergenic
955621047 3:60864350-60864372 CTATCGGTAAGTGGTGGAGCTGG + Intronic
956025175 3:64975734-64975756 CAGTAAGTAAGTGACAGAGCGGG - Intergenic
956466664 3:69526567-69526589 CAGCTGGTAAGTGATGAAGCCGG - Intronic
956703024 3:71975532-71975554 GTGACAGTAAGTGATGGTGCTGG - Intergenic
956855564 3:73271625-73271647 CAGCTAGTAAGTGATGAAACCGG + Intergenic
957490254 3:80916963-80916985 CAGTAAGTAGGAGATGGAGCCGG + Intergenic
959602008 3:108197805-108197827 CAGCTAGTAAGTCATGGAGGTGG - Intronic
959761589 3:109972226-109972248 CAGGTAGTTAGTAATGGAGCTGG + Intergenic
959874487 3:111365963-111365985 CTGGTAATCAGTGACGGAGCTGG - Intronic
960166866 3:114412181-114412203 GTGTTAGTAAGTTGTAGAGCAGG - Intronic
960313924 3:116152399-116152421 CAGCTAGTCAGTGGTGGAGCTGG + Intronic
960440125 3:117676557-117676579 CAGTTAGGAAGTGAAGGAGAAGG + Intergenic
960533127 3:118787696-118787718 CAGTTAGTAAGTGAGAGAGATGG - Intergenic
960810045 3:121619353-121619375 GTGTTAGTCTGTGATGGAGTGGG - Intronic
961368030 3:126413731-126413753 CTGTTTGTTAGTGATGGGCCTGG - Intronic
962278277 3:134031473-134031495 CAGCTAGCAAGTGGTGGAGCTGG + Intronic
962350469 3:134652102-134652124 CAGCCAGGAAGTGATGGAGCTGG - Intronic
963298418 3:143573034-143573056 CCAACAGTAAGTGATGGAGCTGG - Intronic
963613743 3:147507766-147507788 CTCTTATTAAGTGATGGATGTGG - Intronic
964295739 3:155231119-155231141 CTATTGGTAAGTGATGGTGTTGG - Intergenic
964420322 3:156495620-156495642 CAGCTAGTAAGTGATGGAGCTGG - Intronic
964449852 3:156801601-156801623 AAGTTAGTAAGTGATGGAGTTGG - Intergenic
965191509 3:165535985-165536007 CAGCTAGTAAGTGACAGAGCTGG - Intergenic
965817743 3:172654215-172654237 GTGCTGGTAAGTGAGGGAGCTGG - Intronic
966508343 3:180732296-180732318 CAGTTAGTAAGTGGTGAAGATGG + Intronic
966890499 3:184404344-184404366 CTGTTAGTAAGTGGCTGAGCTGG + Intronic
966913411 3:184571629-184571651 CTGTTAGGAAGAGAGGGAGAGGG - Intronic
967120340 3:186377268-186377290 CAGTGACTAAGTGGTGGAGCTGG + Intergenic
967120932 3:186382331-186382353 TGGCTAGTAAGTGATAGAGCTGG + Intergenic
967130465 3:186465700-186465722 CTGTAAGGGAGTGAGGGAGCCGG - Intergenic
967320520 3:188190425-188190447 CTGCTGGTAAGTGAGGGAGAAGG + Intronic
967895745 3:194395198-194395220 CAGTTAGTAAGTGGTAGAGCTGG + Exonic
968011976 3:195288228-195288250 ATTTTAGTAAGTGATGGAGTTGG - Intronic
969029340 4:4198776-4198798 CTGTAAGTAAATGATGAAACAGG + Intronic
969126168 4:4949833-4949855 CAGTCAGTAAGGGATGGAGCTGG - Intergenic
969158601 4:5235332-5235354 CAGCCAGTAAATGATGGAGCTGG - Intronic
969490129 4:7494885-7494907 CTGGAAGTGGGTGATGGAGCAGG + Intronic
969521984 4:7683708-7683730 CTGCCAGTAAGTGATAGAGCTGG + Intronic
969641983 4:8404319-8404341 CTGCTAGTTAATGTTGGAGCTGG - Intronic
970731219 4:19105849-19105871 CAGTTAGTAGGTGAAAGAGCAGG - Intergenic
971039578 4:22736662-22736684 CAGATAGTAAGTGATGTAGCTGG - Intergenic
971073314 4:23119804-23119826 CTGCTAATGAGTGGTGGAGCTGG + Intergenic
971261630 4:25062483-25062505 TAGCTATTAAGTGATGGAGCTGG - Intergenic
971302460 4:25453069-25453091 CTGATAATAAGTGACAGAGCTGG + Intergenic
971447523 4:26766718-26766740 CAGTTAGTAAATAGTGGAGCTGG - Intergenic
971562187 4:28093631-28093653 CTTTTAGTGAATGATAGAGCTGG - Intergenic
971778978 4:31005926-31005948 GTGCTAGTAAGTGATGAAGTTGG - Intronic
973117657 4:46481160-46481182 CTGTTAGAATGTGACAGAGCTGG - Intergenic
974088395 4:57285149-57285171 CAGCTAGTAAGAGATGGGGCTGG + Intergenic
974882524 4:67777293-67777315 CAGTTAGTAAGTGACAGAGCTGG + Intergenic
974897829 4:67960415-67960437 AAGCTAGTAAGTGAAGGAGCTGG - Intronic
975114025 4:70659226-70659248 ATTTTAGTAAGTAATGGAGTTGG + Intronic
975828668 4:78346435-78346457 CAGTTAGTAAGTCCTGGAGCTGG + Intronic
975893722 4:79060639-79060661 CAATTAGTAAGTCATGGAGCTGG - Intergenic
976397753 4:84574464-84574486 CTCCTGGTAAGTAATGGAGCTGG + Intergenic
976745465 4:88398927-88398949 CTGTTAGTAAGTGGTAGAGCTGG + Intronic
977228278 4:94420662-94420684 CTGTTAGTATGTGGTCGAGCAGG + Intergenic
977415805 4:96731891-96731913 CTGTTACTAACTGAGGGACCTGG + Intergenic
978093796 4:104750373-104750395 CAGTTAGGAAGTGATGGAGAAGG + Intergenic
978407561 4:108396100-108396122 CAGCTAATAAGTGATGGACCTGG - Intergenic
978876963 4:113652163-113652185 CAGTTAGTAAATGGTGGAGTTGG - Intronic
978887906 4:113787461-113787483 CAGGTAGTATGTGATGGAGCTGG - Intergenic
979131875 4:117057285-117057307 CTGTTAGAAAGTCAAGGAGCTGG + Intergenic
980169687 4:129274164-129274186 CAGTTAGTAAGTGACAGAGCTGG - Intergenic
980780940 4:137491210-137491232 CAGATAATAAGTGAAGGAGCTGG + Intergenic
981667439 4:147245826-147245848 TTTTAAGTAAGTGATGGAACTGG - Intergenic
983518730 4:168684440-168684462 CCGTTAGGAAGTGATAGAACTGG - Intronic
985386998 4:189458552-189458574 CACTCAGTAAGTGAAGGAGCTGG - Intergenic
988784799 5:34556592-34556614 CAGTTTGTCAGTGGTGGAGCTGG - Intergenic
989088073 5:37696969-37696991 CAGTTAGTAAGTAGTAGAGCTGG - Intronic
989131751 5:38113989-38114011 CTGCTAGAAAGTGCTGGAGGTGG + Intergenic
989502442 5:42184095-42184117 CTGCTAGAAAGTGTTGGAGCTGG + Intergenic
990275880 5:54195876-54195898 CAGCTAATAAGTGATGGAGTGGG + Intronic
990371676 5:55125844-55125866 TGGTTAGTAAGTGATGGAGTTGG - Intronic
990931659 5:61098266-61098288 CAGACAGTAAGTGATGAAGCTGG + Intronic
991354066 5:65749291-65749313 GAGTTAGTAAGGGATGTAGCAGG + Intronic
991469157 5:66949221-66949243 CAGTTAATAAGTGATTGAGCTGG - Intronic
992007112 5:72488850-72488872 AAGTTAGGAAGTGATGGAGCTGG - Intronic
992075999 5:73193182-73193204 CAGGTAGTAAGTAATAGAGCTGG + Intergenic
992226077 5:74620749-74620771 ATTTTAGTGAGTGATGGAGTTGG + Intergenic
994400042 5:99267156-99267178 CTGTTGGGCAGAGATGGAGCTGG + Intergenic
994511234 5:100706303-100706325 ATATTAGTAAGTGATAGAGCTGG - Intergenic
995424749 5:112008087-112008109 CTGTTAGAAACTGCTGGAGTTGG - Intergenic
995702316 5:114950167-114950189 CAGTTAGTAAATAATTGAGCTGG - Intergenic
996409044 5:123136963-123136985 CAGTTAGAAAGAGATGTAGCTGG - Intronic
996691347 5:126343542-126343564 CTGTTAGTAAGTAACTGAGCTGG - Intergenic
997037484 5:130210292-130210314 CAGCTATTAAGTGATTGAGCTGG + Intergenic
997755205 5:136389675-136389697 CAGTAAGTAAGTAATGGAACTGG + Intronic
997860156 5:137408816-137408838 CAGCTAGTAAGTGGTGGAGCTGG - Intronic
998115732 5:139535828-139535850 CAGTTAGTAATTGTTGAAGCTGG - Intronic
998487314 5:142514035-142514057 CTGTTAGCAGGTGATGGACTTGG + Intergenic
998507059 5:142680509-142680531 CTGGTAGTAAGTGACTGAGTGGG - Intronic
999089607 5:148924650-148924672 CTGTTAGTAAGTAATGGAGCTGG + Intronic
999875795 5:155804346-155804368 CTGTTAGAAAGTGATAGAGGAGG + Intergenic
1000144039 5:158435662-158435684 CAGTTAATGAGTGATGAAGCTGG - Intergenic
1000160030 5:158588200-158588222 CTGATAGTAAGGAATAGAGCTGG - Intergenic
1000241247 5:159410334-159410356 CCATCAGTAAGTGATGGAGCTGG - Intergenic
1000461688 5:161529461-161529483 CAGCTAGAAAGTGCTGGAGCTGG - Intronic
1000548871 5:162634299-162634321 CTTTTAGCCATTGATGGAGCTGG + Intergenic
1001006091 5:168051692-168051714 CAGTTGCTAAGTGATGGAGCTGG - Intronic
1001128062 5:169038700-169038722 CTGCTATTTAGTGATGGAGATGG + Intronic
1001266739 5:170279275-170279297 CTGTAAGTTAGGGATGCAGCTGG - Intronic
1001303847 5:170557100-170557122 CAGTTAGTAAGTGGCAGAGCTGG - Intronic
1001319353 5:170667652-170667674 CAGCAGGTAAGTGATGGAGCTGG - Intronic
1001404070 5:171463173-171463195 CAGTTATTAAGTGGTGAAGCTGG + Intergenic
1001409255 5:171498588-171498610 CAGCTAGTAAGTGCTGGTGCTGG - Intergenic
1001880157 5:175236431-175236453 CAGTTGGTAAGTCATAGAGCTGG - Intergenic
1001926228 5:175639242-175639264 CGGCTAGAAAGTGATGGAGCTGG + Intergenic
1003061224 6:2864219-2864241 CTCTTACTAAATGATGGAGGAGG - Intergenic
1003442120 6:6152606-6152628 CTGTTAATAAGTGTTGAACCTGG - Intronic
1003516304 6:6821679-6821701 CAGCTACTAAGTGATGCAGCTGG - Intergenic
1003895952 6:10607918-10607940 CAGTTAGTAATTGACAGAGCAGG + Intronic
1003914186 6:10770468-10770490 CAGTTAGTAAGAGACTGAGCTGG + Intronic
1004433533 6:15567853-15567875 CAGCTAGTAAGTGGTGAAGCAGG - Intronic
1004473389 6:15948672-15948694 GAGTTAGTAAGTGGTGGAGCTGG - Intergenic
1004843268 6:19611492-19611514 CAGATAATAAATGATGGAGCTGG + Intergenic
1005002967 6:21261229-21261251 CAGCTAGTAAGTGACAGAGCTGG + Intergenic
1005163052 6:22887458-22887480 CATTTAGGAAGTGGTGGAGCTGG - Intergenic
1005397674 6:25400018-25400040 CAGCTAGTAAATGGTGGAGCTGG + Intronic
1006732917 6:36249741-36249763 CAGCTAGTAAGTGATGAAACAGG - Intronic
1006816264 6:36852452-36852474 CTGCTGCTAAGTGGTGGAGCTGG + Intergenic
1007364062 6:41377990-41378012 TAGATAGTAAGTGGTGGAGCTGG - Intergenic
1007514161 6:42398133-42398155 CAGCTAGCAAGTGCTGGAGCTGG - Intronic
1007660331 6:43480921-43480943 CAGCTAGTAAGTGACAGAGCTGG + Intronic
1007904076 6:45441361-45441383 CAGTTAATAAATGATGGAGTTGG - Intronic
1008058928 6:46976290-46976312 CAGTTAGTAAGTGATGAAGCTGG + Intergenic
1008357014 6:50566584-50566606 CAGTTAGCAAGTGGTGAAGCTGG - Intergenic
1008625065 6:53307307-53307329 CAGCTAGTAAGTGGTGAAGCAGG - Intronic
1008667099 6:53726968-53726990 CTGTTATTCAGTGATGAGGCTGG + Intergenic
1010863893 6:80948425-80948447 CTGTATGTCAGTGATGGAGCTGG - Intergenic
1011178357 6:84589261-84589283 CCATTAGTAAATGATGGATCTGG + Intergenic
1012662290 6:101916410-101916432 ATGTTAAAAAGTGATGAAGCAGG + Intronic
1013028231 6:106301940-106301962 CCGCTAGTAAGTGATGAAGCTGG + Intronic
1014086080 6:117345668-117345690 AAGTTAGCAAGTGAAGGAGCTGG - Intronic
1014816868 6:125945524-125945546 CTATTAGTCAGTGACAGAGCTGG - Intergenic
1014818546 6:125960360-125960382 CAGTTAAGAAGTTATGGAGCCGG + Intronic
1015491809 6:133835260-133835282 CTGGTAGTAAGTGGTGGCACTGG - Intergenic
1015993499 6:138973652-138973674 CAGCTAGTAAGTCATTGAGCTGG - Intronic
1016047858 6:139498756-139498778 TTGTTAGTAAGTGATGGAGCTGG - Intergenic
1016246028 6:141981871-141981893 ATGTTAGTAAGTGGCAGAGCTGG + Intergenic
1018251282 6:161873029-161873051 CTGATAATAAGGGAGGGAGCTGG + Intronic
1018535470 6:164814298-164814320 CTTTTAGTCACAGATGGAGCTGG + Intergenic
1019909645 7:4092069-4092091 CAGCTAGAAAGTGATGGAGCTGG - Intronic
1020982227 7:15085189-15085211 CAGATAGTAAGTGACTGAGCTGG - Intergenic
1021988403 7:26119354-26119376 ATGTTAGTAAGTGGCAGAGCTGG + Intergenic
1022191590 7:28021335-28021357 CAGTTAGGAAGTGATGGGCCTGG - Intronic
1022327905 7:29349423-29349445 CAGCTAGTAAGTGACAGAGCTGG + Intronic
1022415599 7:30174060-30174082 CAGCTAGCAAGTGGTGGAGCTGG - Intergenic
1023338380 7:39193528-39193550 CAGTTAGTGAGTGATAGAGTTGG - Intronic
1023354969 7:39357438-39357460 CAGTTTGTAAGAGGTGGAGCTGG + Intronic
1023896359 7:44436333-44436355 GTGTTGCTAAGTGATGAAGCAGG + Intronic
1024519557 7:50292957-50292979 AGGTTAGCAGGTGATGGAGCTGG + Intergenic
1024878195 7:54052138-54052160 CTGATAGGAAGTGGTGGAGCTGG + Intergenic
1025962647 7:66237142-66237164 GTCAGAGTAAGTGATGGAGCAGG - Intronic
1026619726 7:71939680-71939702 CTGCTTGGAAGTGGTGGAGCTGG + Intronic
1027888325 7:83937845-83937867 GTTTTAGTAAGTGGTGGAGGTGG - Intergenic
1028117803 7:87021117-87021139 CAGCTAGTAAGTGATAGAACTGG + Intronic
1028171773 7:87605629-87605651 CAGCTAGTAAGTCATGAAGCTGG - Intronic
1028516955 7:91688261-91688283 CTGGTAGAAAGTGAGGAAGCAGG + Intergenic
1028832021 7:95338744-95338766 CAGTTAGTAAGTGACTGAACTGG + Intergenic
1029843521 7:103390259-103390281 CTGTCAGTAGGTTATAGAGCAGG + Intronic
1030950671 7:115787575-115787597 ATGTAAGTAAGTCATGGTGCAGG + Intergenic
1031961035 7:127990273-127990295 CAGCTAATAAGTGATAGAGCTGG + Intronic
1032024800 7:128432571-128432593 TTGCTAATAAGTGATGGAGCTGG - Intergenic
1032144004 7:129362217-129362239 CAGCTAGTAAGTGATGAAACTGG + Intronic
1032739974 7:134729351-134729373 CAGCTAGTAAATGGTGGAGCTGG + Intergenic
1032841418 7:135716705-135716727 CAGCTACTAAGTGGTGGAGCTGG - Intronic
1033303366 7:140206217-140206239 CTGGTATTAGGTGGTGGAGCTGG - Intergenic
1033651725 7:143348893-143348915 CAGTCAGTAATTGGTGGAGCTGG - Intronic
1034826741 7:154272209-154272231 CTGTTAAAAATGGATGGAGCAGG - Intronic
1036048728 8:5172318-5172340 TAGTTAGTAAGTGTTGGAACAGG - Intergenic
1036063879 8:5356605-5356627 CAGCTAGTAAGGGGTGGAGCTGG - Intergenic
1037528529 8:19751214-19751236 CAGCTAGTAAGTGGTGTAGCTGG - Intronic
1037561439 8:20078377-20078399 CAGCTAGTAAGTGGTAGAGCAGG - Intergenic
1037615863 8:20518566-20518588 CGGCTATTAAGTGATAGAGCAGG - Intergenic
1038037294 8:23697081-23697103 CTGTGAGTTAGTGATGGAACTGG - Intergenic
1038307140 8:26414971-26414993 CTGTTAGTAAATTATGGTTCAGG + Intronic
1038703689 8:29874691-29874713 CAGGCAGTAAGTGATCGAGCTGG + Intergenic
1038832447 8:31076219-31076241 CTCTGAGGAAGTGATGGATCTGG + Exonic
1039010543 8:33088765-33088787 CTGTTACTGAGGGATGGATCTGG - Intergenic
1039181871 8:34876087-34876109 CGGTTAGTAAGTGGTAGAGCAGG + Intergenic
1039948707 8:42151961-42151983 CAGGTTGTAAGTGTTGGAGCGGG + Intergenic
1040788615 8:51197783-51197805 CTGTTTTTAAGTGTTGGAGTAGG - Intergenic
1040917374 8:52577016-52577038 CAGCTATTAAGTGATGGAGCTGG - Intergenic
1041620194 8:59958323-59958345 CTGTTACTAAGTGGAGGAGGAGG - Intergenic
1042085289 8:65100852-65100874 CAATTAGTAAGTAGTGGAGCTGG + Intergenic
1042349776 8:67765501-67765523 CTGATAGTAAGTGCTAGGGCTGG + Intergenic
1042540044 8:69898746-69898768 TAGTTAGTAAGTGGTGGAGCTGG - Intergenic
1042600609 8:70495720-70495742 CAGCTAGCAAGTGATGAAGCTGG + Intergenic
1043159687 8:76830077-76830099 CCCATAGCAAGTGATGGAGCTGG - Intronic
1043478068 8:80624830-80624852 CAGTTAGTAAATGGTGAAGCTGG + Intergenic
1043542986 8:81283069-81283091 CAACTAGAAAGTGATGGAGCTGG - Intronic
1043687875 8:83110722-83110744 TTGTTAGGAACTGATGCAGCTGG - Intergenic
1044295732 8:90525111-90525133 CTGCTAATAACTGATTGAGCTGG - Intergenic
1044515462 8:93133266-93133288 CTGTTACTGAGTGATGGTGCTGG - Intergenic
1044612012 8:94100920-94100942 CAGCTAGTAAGTGGTGGAGCTGG + Intergenic
1045845794 8:106634516-106634538 CAAGTAGTAAGTGATGGAGGTGG + Intronic
1046461654 8:114546284-114546306 TTATTAATGAGTGATGGAGCAGG - Intergenic
1046565919 8:115901024-115901046 CTGGATGTAAGTGATGTAGCCGG - Intergenic
1046640807 8:116728763-116728785 CAGCTAGTAAATGCTGGAGCTGG - Intronic
1047018718 8:120751676-120751698 TAACTAGTAAGTGATGGAGCTGG - Intronic
1047215780 8:122874917-122874939 TTGCTAGTAAGGGATAGAGCTGG - Intronic
1047818703 8:128494452-128494474 CTGTTTGAAAATGATGGAGCTGG - Intergenic
1048437064 8:134428042-134428064 CAGTTAGTAATGGGTGGAGCTGG - Intergenic
1049252030 8:141594331-141594353 CTGTCATTACGTGATGGAGTGGG - Intergenic
1050012602 9:1200309-1200331 CAGCTAGTAAGTGACAGAGCTGG - Intergenic
1050341067 9:4638979-4639001 TAGTTGGTAAGTGGTGGAGCAGG - Intronic
1050662490 9:7898314-7898336 CTGCTAGTAAGTACTAGAGCTGG + Intergenic
1051018588 9:12512816-12512838 CAGTTAATACATGATGGAGCAGG + Intergenic
1051658865 9:19408151-19408173 CTATTAGCAAGTGACAGAGCTGG - Intergenic
1051680481 9:19602708-19602730 CAGGTAGAAACTGATGGAGCTGG - Intronic
1053414916 9:37941422-37941444 CTGTTAGTATGTGGCGGAGCTGG + Intronic
1054735952 9:68749926-68749948 CAGCTACTTAGTGATGGAGCTGG - Intronic
1054778048 9:69140388-69140410 CAGCTAGTCAGTGATGGAGCTGG + Intronic
1054830708 9:69621540-69621562 CAGTTAATAAGTGATGGGCCAGG - Intronic
1054841458 9:69745684-69745706 TTCCCAGTAAGTGATGGAGCTGG - Intronic
1055730664 9:79276752-79276774 CTGCTAGTAAGTGGTGAAGCTGG + Intergenic
1056174644 9:84022152-84022174 AAGTTATTCAGTGATGGAGCAGG + Intergenic
1057195671 9:93114664-93114686 CAGTTGGTCAGGGATGGAGCTGG - Intergenic
1057402959 9:94740766-94740788 CAGTTTGTAACTGATGAAGCCGG - Intronic
1057747030 9:97760682-97760704 CTGCTTGTAAGTGACAGAGCTGG + Intergenic
1057752619 9:97804391-97804413 CTGTTAGAGAGGGATGGAGTGGG + Intergenic
1057874724 9:98745233-98745255 CAGTGAATAAGTGAAGGAGCTGG + Intronic
1058195871 9:101974799-101974821 CAGCTAGTAAGTGGTGGAGCTGG - Intergenic
1058382557 9:104393759-104393781 CAGCAAGTAAGTGAAGGAGCAGG + Intergenic
1058637286 9:107048962-107048984 CATTTAGTAAGTGATGGAGTGGG + Intergenic
1058743312 9:107965853-107965875 CAGTTACAAAGGGATGGAGCTGG - Intergenic
1059029422 9:110675160-110675182 GAGTCGGTAAGTGATGGAGCTGG + Intronic
1059395916 9:114033989-114034011 CAGCTAGTAAGTGGTGGAGCTGG - Intronic
1059721806 9:116967299-116967321 CAGCTAGTCAGTGGTGGAGCTGG + Intronic
1060085104 9:120691717-120691739 CAGGGAGTAAGTGATGGAGCTGG + Intronic
1060151849 9:121293975-121293997 CTGCTAATAAGTGATAGACCGGG + Intronic
1060464487 9:123890739-123890761 CAGTTTGTAAGAGATAGAGCTGG + Intronic
1061076925 9:128347323-128347345 CAGTTAGTAAGTGGTAGAACTGG + Intronic
1186543223 X:10422257-10422279 CTTGTAGTTTGTGATGGAGCTGG + Intergenic
1186567350 X:10677660-10677682 GTGTTAGTATGTAGTGGAGCTGG - Intronic
1186573496 X:10740571-10740593 CTGCAAGTAAATGATGGAGCAGG - Intronic
1186683205 X:11897473-11897495 GTGTTAGTAATTGTTGAAGCTGG + Intergenic
1186732109 X:12420854-12420876 TTGTGGTTAAGTGATGGAGCTGG - Intronic
1187003122 X:15202613-15202635 CAGCTAATAAGTGATGGAGCTGG + Intergenic
1187124688 X:16444237-16444259 CAGCTAGTAAGTGATGGAGCTGG + Intergenic
1187684003 X:21798361-21798383 CAATTGGTAAGTGGTGGAGCTGG - Intergenic
1188444828 X:30245487-30245509 CAGCTAGTAAGTGATAGGGCTGG + Intronic
1189141931 X:38616304-38616326 CAGCTAGTAAGTGGTGGAGCTGG + Intronic
1189220596 X:39368536-39368558 CAGGTAGTAAGTGGTGGAGGAGG + Intergenic
1189712598 X:43828757-43828779 CAGTTGGTAAGTGATGGAGTGGG - Intronic
1190624476 X:52323616-52323638 CAGTTAGTAAGTGATGGAGCTGG - Intergenic
1190738077 X:53268824-53268846 CGGCTAGTAAATGATGGGGCTGG - Intronic
1190775410 X:53548653-53548675 TGATTAGAAAGTGATGGAGCTGG - Intronic
1190787097 X:53662268-53662290 CAGTGAGTAAGTGATATAGCAGG - Intronic
1190989054 X:55526952-55526974 CTAAGAGTAAGTGATGCAGCGGG - Intergenic
1192048125 X:67698074-67698096 CAGCTAGTCAGTGATAGAGCCGG + Intronic
1192262624 X:69515952-69515974 CAGCTAGTAAGAGTTGGAGCTGG + Intronic
1192447069 X:71218938-71218960 TAGTCAGTAAGTGATAGAGCTGG - Intronic
1192593912 X:72386733-72386755 CAGCTAGTAAGTGGTGAAGCTGG + Intronic
1192608621 X:72545498-72545520 GAGGTAGTAATTGATGGAGCTGG + Intronic
1193173621 X:78366034-78366056 CAGTTAGTTAGTGATGTAGCTGG + Intergenic
1193430623 X:81399482-81399504 CTGCTAGTAAGTAGTAGAGCTGG - Intergenic
1194278841 X:91922323-91922345 CAGTTAGTAAGTGGTAAAGCTGG + Intronic
1194412564 X:93575015-93575037 CAGTTAGCAAATGATGAAGCTGG + Intergenic
1195003844 X:100667921-100667943 TAGCTAGTAAGTGGTGGAGCTGG + Intronic
1195468387 X:105206392-105206414 TGGGTAGTAAATGATGGAGCTGG + Intronic
1195728163 X:107938248-107938270 CAGCTAGAAAGTGGTGGAGCAGG - Intergenic
1196236152 X:113283119-113283141 CAGATAGTCAGTGATGGAGCTGG + Intergenic
1196407751 X:115383033-115383055 AGTTAAGTAAGTGATGGAGCTGG - Intergenic
1196673313 X:118392398-118392420 AAGCTAGTAAGTGATGAAGCAGG - Intronic
1196892406 X:120304133-120304155 CTGTTAGATAGGGATGGTGCTGG + Intronic
1198006476 X:132499627-132499649 CAGCTAGTAAGTGACAGAGCAGG - Intergenic
1198428228 X:136540863-136540885 CTGTTAGTAAGTGATGGAGCTGG - Intronic
1198511152 X:137353105-137353127 CTGCTAGTAAGTGTCTGAGCAGG + Intergenic
1198544749 X:137679593-137679615 ATGCTAGTAAGTAGTGGAGCAGG + Intergenic
1198829462 X:140733416-140733438 GAACTAGTAAGTGATGGAGCTGG - Intergenic
1199738473 X:150708895-150708917 CAGTAAGTAGGTGCTGGAGCTGG + Intronic
1199766489 X:150945339-150945361 TTGCTAGTAAGTGATGGAGCTGG + Intergenic
1200225307 X:154413685-154413707 CTGCTGGCATGTGATGGAGCTGG - Intronic
1200303011 X:154997461-154997483 CTGCTAGAAAGTGATGAGGCAGG + Intronic
1200596320 Y:5145824-5145846 CAGTTAGTAAGTGGTAAAGCTGG + Intronic