ID: 1198431004

View in Genome Browser
Species Human (GRCh38)
Location X:136566022-136566044
Sequence TTGGCTACACACAGACACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198431004_1198431008 18 Left 1198431004 X:136566022-136566044 CCTTTGTGTCTGTGTGTAGCCAA No data
Right 1198431008 X:136566063-136566085 AAGTAAGAACATGCCATATTTGG 0: 2
1: 62
2: 475
3: 2998
4: 8071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198431004 Original CRISPR TTGGCTACACACAGACACAA AGG (reversed) Intergenic
No off target data available for this crispr