ID: 1198432928

View in Genome Browser
Species Human (GRCh38)
Location X:136586061-136586083
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198432927_1198432928 11 Left 1198432927 X:136586027-136586049 CCATTGCTATGATTATGAAAAGT No data
Right 1198432928 X:136586061-136586083 GAGTTCCACCAGTAGTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198432928 Original CRISPR GAGTTCCACCAGTAGTTAAG AGG Intergenic
No off target data available for this crispr