ID: 1198435912

View in Genome Browser
Species Human (GRCh38)
Location X:136616788-136616810
Sequence GTGTGGGTATGTGAGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198435912_1198435919 -6 Left 1198435912 X:136616788-136616810 CCCACTCCCTCACATACCCACAC No data
Right 1198435919 X:136616805-136616827 CCACACACACCCTTATTAGGTGG No data
1198435912_1198435916 -9 Left 1198435912 X:136616788-136616810 CCCACTCCCTCACATACCCACAC No data
Right 1198435916 X:136616802-136616824 TACCCACACACACCCTTATTAGG No data
1198435912_1198435920 0 Left 1198435912 X:136616788-136616810 CCCACTCCCTCACATACCCACAC No data
Right 1198435920 X:136616811-136616833 ACACCCTTATTAGGTGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198435912 Original CRISPR GTGTGGGTATGTGAGGGAGT GGG (reversed) Intergenic
No off target data available for this crispr