ID: 1198436475

View in Genome Browser
Species Human (GRCh38)
Location X:136621631-136621653
Sequence GTTTGAAAGGTGAAGATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198436472_1198436475 27 Left 1198436472 X:136621581-136621603 CCGGAAGGGAACACTTTTCACTT No data
Right 1198436475 X:136621631-136621653 GTTTGAAAGGTGAAGATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198436475 Original CRISPR GTTTGAAAGGTGAAGATAAC AGG Intergenic
No off target data available for this crispr