ID: 1198439221

View in Genome Browser
Species Human (GRCh38)
Location X:136645778-136645800
Sequence GTGGCAACCAAGGTTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198439212_1198439221 16 Left 1198439212 X:136645739-136645761 CCTGGAATAGGATGATGGCAGGG No data
Right 1198439221 X:136645778-136645800 GTGGCAACCAAGGTTTTTGGAGG No data
1198439218_1198439221 -8 Left 1198439218 X:136645763-136645785 CCATGGAGAGAAGTGGTGGCAAC No data
Right 1198439221 X:136645778-136645800 GTGGCAACCAAGGTTTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198439221 Original CRISPR GTGGCAACCAAGGTTTTTGG AGG Intergenic
No off target data available for this crispr