ID: 1198439664

View in Genome Browser
Species Human (GRCh38)
Location X:136650893-136650915
Sequence GAGATCTTTCCCTTTTACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198439664 Original CRISPR GAGATCTTTCCCTTTTACTG GGG Intronic
905762220 1:40569171-40569193 GAGATATTTCCATTTCAATGAGG - Intergenic
905964427 1:42080396-42080418 AAGATCTTTACCTTTGACTCTGG + Intergenic
906504767 1:46370684-46370706 GGGATTTTTCCCTTTTTATGTGG - Intergenic
907660116 1:56384091-56384113 GAGTTCTTTAGCTTTTACTGAGG - Intergenic
909067358 1:70951473-70951495 AATATCTTTGCCTTTTACTTTGG + Intronic
909485278 1:76166074-76166096 GAAATCTTTCCCTGTTTCTATGG + Intronic
911755337 1:101547657-101547679 GAGATCCTTCCCTTGATCTGGGG - Intergenic
913526417 1:119697725-119697747 CTAATTTTTCCCTTTTACTGAGG + Intronic
914798615 1:150942830-150942852 TTTATCTTTCCCTTTTACTCAGG + Exonic
914940197 1:152015860-152015882 GAATTATTTCCCTTTTACTAGGG - Intergenic
916335966 1:163671592-163671614 GTGATGTTTCCTTTGTACTGTGG + Intergenic
917526170 1:175790371-175790393 GAGATCTTTACCATTTAATATGG - Intergenic
917941712 1:179928738-179928760 GGGGTCTTTCTCTGTTACTGAGG + Intergenic
918140624 1:181716654-181716676 AAGACCTTTCCCTTTTTCTGGGG - Intronic
919648554 1:200122179-200122201 CAGAACTTTCCTTTTTATTGTGG - Intronic
1063542088 10:6944110-6944132 GCGATCTTTCTCTTTCTCTGAGG - Intergenic
1063570040 10:7207032-7207054 GAGGTCTTGCCATGTTACTGAGG - Intronic
1064068994 10:12209079-12209101 GAGAACTTTCTCATATACTGAGG + Intronic
1065996269 10:31062258-31062280 CAGATCTTTCCATCTTACCGAGG - Intergenic
1067027214 10:42854490-42854512 GAGAACTTTCCATATTACTAAGG + Intergenic
1067371348 10:45686064-45686086 GGGATCTTTTCATTTTATTGAGG + Intergenic
1067388436 10:45840087-45840109 GGGATCTTTTCATTTTATTGAGG - Intronic
1067417630 10:46116872-46116894 GGGATCTTTTCATTTTATTGAGG + Intergenic
1067445831 10:46344492-46344514 GGGATCTTTTCATTTTATTGAGG + Intergenic
1067503044 10:46823760-46823782 GGGATCTTTTCATTTTATTGAGG + Intergenic
1067591548 10:47516250-47516272 GGGATCTTTTCATTTTATTGAGG - Intronic
1067638663 10:48024325-48024347 GGGATCTTTTCATTTTATTGAGG - Intergenic
1067874818 10:49995980-49996002 GGGATCTTTTCATTTTATTGAGG + Intronic
1069314987 10:67087188-67087210 GTGATGTTTCTCTTTAACTGAGG - Intronic
1069521583 10:69125371-69125393 GCGCTGTTTCCATTTTACTGGGG - Intronic
1070135267 10:73688763-73688785 GGGATCTTTTCATTTTATTGAGG - Intronic
1072392426 10:95000631-95000653 TATTTTTTTCCCTTTTACTGAGG - Intergenic
1072637491 10:97187067-97187089 GAGATCTTTCGTCTTTTCTGGGG - Intronic
1072960182 10:99922375-99922397 GATATCTCTCGCTTTTACAGAGG + Intronic
1073417385 10:103395894-103395916 GAAATCTAACCCTTTTACAGCGG + Exonic
1074070044 10:110058365-110058387 GAGATCTTGCCCTTTTTCACAGG - Intronic
1074930628 10:118122145-118122167 GTGATCTTGCCCTTATTCTGTGG + Intergenic
1075455647 10:122583191-122583213 CAGGTCTTTGCCTTTTAGTGTGG + Intronic
1075457770 10:122595894-122595916 CAGGTCTTTGCCTTTTAGTGTGG + Intronic
1078009002 11:7555985-7556007 GAAATGTGTCCATTTTACTGAGG + Intronic
1082803393 11:57430977-57430999 GAGACCTTTCTCTTTAACAGAGG + Intergenic
1083090639 11:60196058-60196080 GCTATCTTGACCTTTTACTGGGG + Intergenic
1083127758 11:60589540-60589562 TAGATCTCTCCGTTTTTCTGAGG - Intergenic
1085988679 11:81813377-81813399 AACATCTTTTTCTTTTACTGTGG - Intergenic
1086375546 11:86196340-86196362 GTGATCCTTCCCTTTGCCTGTGG + Intergenic
1093009725 12:14093797-14093819 GAGATTTTGCCATGTTACTGAGG - Intergenic
1094245188 12:28283151-28283173 CAGATTTTTCCCTTTTGCTTAGG + Intronic
1094265368 12:28552978-28553000 GAGTTTTGTCCCTTTTATTGAGG + Intronic
1097402072 12:59140216-59140238 GAGTTCTTTCCAATTTACTAGGG - Intergenic
1098390573 12:69965745-69965767 GAAATCTTTCCTTTTAAGTGTGG + Intergenic
1099504923 12:83462168-83462190 TGGATTTTTCCCTTTGACTGTGG - Intergenic
1099709188 12:86198553-86198575 CAGATCTTCTCATTTTACTGGGG + Intronic
1099743742 12:86675172-86675194 AAGTGCATTCCCTTTTACTGGGG - Intronic
1099851444 12:88102150-88102172 GAACTCTATACCTTTTACTGAGG - Intronic
1100007285 12:89909646-89909668 CAGATCCTTCCCTTTTGCTAGGG + Intergenic
1102128977 12:110510101-110510123 GAGATCTTTGGCTTTTACCCTGG - Intronic
1103137688 12:118521845-118521867 ATGATCTTTCCCTTATACTCTGG - Intergenic
1106367659 13:29098151-29098173 GAGATATTTGACTTATACTGTGG + Intronic
1108011050 13:46010855-46010877 GAGATCTTTCTCTATTACCCAGG - Intronic
1108706742 13:52995661-52995683 GAGAGCTTTTGCTTTTAATGAGG + Intergenic
1108962318 13:56249085-56249107 GAGATCTTTCCATCTTTTTGAGG + Intergenic
1108992411 13:56677199-56677221 GAGAGCTTTCACTTATACAGAGG - Intergenic
1110337563 13:74349329-74349351 CAGTTCTTTCGCATTTACTGAGG - Intergenic
1113081240 13:106522751-106522773 GAAACCTTTCCCTTTTGGTGGGG + Intronic
1115508283 14:34113514-34113536 GATTTCTTTTTCTTTTACTGTGG + Intronic
1115982858 14:39072785-39072807 GGGGTCTTTCTCTGTTACTGAGG - Intronic
1116530578 14:45967854-45967876 GAGTTGTTTTCCTTTTACAGTGG + Intergenic
1117053898 14:51890603-51890625 GATAACTTTCCATTTTACTTTGG + Intronic
1120333556 14:83124923-83124945 GAAATCTTTTTCTCTTACTGCGG - Intergenic
1120624885 14:86812889-86812911 TAGATCTTTCCCACTTTCTGAGG + Intergenic
1125995167 15:44152551-44152573 GAGCTTTTTCCCATTTACTGAGG - Intronic
1127485722 15:59416056-59416078 GTGCTCTTTCCATTTTTCTGTGG - Intronic
1128005656 15:64238117-64238139 GAAATCTTGCTCTTTCACTGGGG + Intronic
1131704425 15:94977291-94977313 GAGATCTTTCCCTTTCTGTAAGG + Intergenic
1131741972 15:95402749-95402771 GGGATCCTTACCTTATACTGAGG + Intergenic
1135266086 16:21026955-21026977 GAGAGCTTTCTCTTTTGCTTAGG + Intronic
1135924275 16:26678622-26678644 AAGGTCTTTCCCTATTTCTGTGG - Intergenic
1136585452 16:31181280-31181302 GTCCTCTTTCCCTTTTCCTGCGG + Intronic
1137580971 16:49633276-49633298 GATATTTTTCCCTTTTACAATGG - Intronic
1142222445 16:88862161-88862183 GAAATCTTTGCCTTTTAGTGGGG + Exonic
1143663463 17:8341712-8341734 GAGTTCTTTCCCTGCTCCTGGGG + Intronic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1147470196 17:40651316-40651338 GAGTTCTTTCCATTGTTCTGTGG + Intergenic
1147491037 17:40866610-40866632 GAGATCTTACCTTATTCCTGAGG + Exonic
1150051389 17:61967776-61967798 GATATATATCCCTTTTAATGTGG - Intronic
1150247599 17:63688224-63688246 GAGCTCTTTGCCTGTTACAGAGG + Intronic
1150783395 17:68142116-68142138 TAGATTTATCCCTTTTACTTTGG - Intergenic
1150982663 17:70159997-70160019 GCCAGCTTTCCCATTTACTGAGG - Intergenic
1154987603 18:21568345-21568367 GTGATCCTCCCCTTTTAGTGAGG - Intronic
1156510648 18:37633891-37633913 GAGTTCTTGCCATTCTACTGGGG - Intergenic
1156762902 18:40614803-40614825 GAGGTCTTTCTCTTTTCCTGTGG + Intergenic
1159486645 18:69068886-69068908 CAAATCTTTCCATTTTTCTGAGG + Intergenic
1160914918 19:1491754-1491776 GAGATCTTCCCGTTTTTCTGAGG + Intronic
1164923790 19:32109981-32110003 GACATGCTTCCCTTTTACTTGGG + Intergenic
1166432784 19:42741133-42741155 GAGAACTGTCCCTTTGACTATGG - Intronic
1166435895 19:42766360-42766382 GAGAACTGTCCCTTTGACTATGG - Intronic
1166448758 19:42880348-42880370 GAGAACTGTCCCTTTGACTATGG - Intronic
1166453164 19:42918536-42918558 GAGAACTTTCCCTTTGACTATGG - Intronic
1166465442 19:43027122-43027144 GAGAACTTTCCCTTTGACTATGG - Intronic
1166485185 19:43206276-43206298 GAGAACTGTCCCTTTGACTCTGG - Intronic
1166492336 19:43270194-43270216 GAGAACTGTCCCTTTGACTATGG - Intergenic
1167992060 19:53369086-53369108 AAGGTCCTTCCCTTTTACCGAGG - Intronic
926901271 2:17753980-17754002 ATTATCTTTCCCTTTTACTTAGG - Intronic
926961182 2:18360052-18360074 AATATGTTTCCCTCTTACTGAGG - Intronic
928945931 2:36771965-36771987 GAGTTGTATCCCTTTTTCTGTGG - Intronic
931166345 2:59753394-59753416 GTGAGCATTCCCTTTTTCTGAGG + Intergenic
931992233 2:67802127-67802149 GAGATGTGTCCCCTTTCCTGTGG - Intergenic
936706534 2:115081590-115081612 GATGTCTTTACCTTTTGCTGTGG + Intronic
936877815 2:117213699-117213721 GGCTTCTTTCCCTTTTACAGGGG - Intergenic
936951669 2:117983689-117983711 GAGATCTTTCCCATTAAATGAGG - Intronic
937020790 2:118652322-118652344 GAGAGCTTTCTTTTTTATTGTGG - Intergenic
939151188 2:138474717-138474739 GAGATATTTTCTTTTTCCTGAGG + Intergenic
939419084 2:141942752-141942774 GGGGTCTTTCTATTTTACTGTGG + Intronic
939653899 2:144798789-144798811 CAGATCTTTGCATTTTACAGTGG - Intergenic
941776366 2:169397854-169397876 GTGTTCTTTCCCTGTGACTGTGG + Intergenic
941901134 2:170679523-170679545 CAGAGCTTTCCCTTTAACTGTGG - Intergenic
941983520 2:171486866-171486888 TAGATCATTCCTTTTTATTGTGG + Intergenic
942917167 2:181324630-181324652 GAGAACTTTTCCTTTTGGTGTGG - Intergenic
944035748 2:195292545-195292567 CAGTTCTTTCGCATTTACTGAGG - Intergenic
946031676 2:216710439-216710461 GAGATCTTTACGGTTTTCTGTGG + Intergenic
946221411 2:218230848-218230870 TAGATCTTTTCCTTTTTTTGAGG - Intronic
946965438 2:225032129-225032151 GAGATCTTATCCTTTTAAAGGGG - Intronic
947084356 2:226434508-226434530 GTGATATTTCCATTTTGCTGAGG + Intergenic
947368973 2:229425536-229425558 GAAGGCTTTGCCTTTTACTGGGG - Intronic
948444713 2:238023253-238023275 TGCATCTTTCCCTTCTACTGAGG - Intronic
1169445679 20:5669338-5669360 GAGGGCTTTCCCTTTGCCTGAGG + Intergenic
1171080230 20:22174210-22174232 GAGATCTTTCACTTTTTGTTAGG + Intergenic
1172570776 20:35968637-35968659 GAGCTCTTGCCTTGTTACTGAGG + Exonic
1174059201 20:47820599-47820621 GAGAACAGTGCCTTTTACTGGGG + Intergenic
1177167949 21:17624089-17624111 GAGACCTTTGTCTTTTACTGTGG - Intergenic
1177221289 21:18196365-18196387 GAAATTTTTTCCTGTTACTGAGG + Intronic
1180975178 22:19844197-19844219 GAGATCAGTCACTTTTGCTGGGG + Intronic
1181436379 22:22913691-22913713 GAGATCCTTCCATTTTACCCTGG + Intergenic
1181610423 22:24007894-24007916 GAGATCTTTCCAAATCACTGAGG - Intergenic
1183548132 22:38466206-38466228 GAAATCATTCCCTTACACTGTGG - Intergenic
1184933158 22:47696769-47696791 GAAATCTTACCCTTTTCCTGCGG + Intergenic
950139820 3:10607738-10607760 GAGATCTTTCTGTTTGAGTGTGG + Intronic
950988184 3:17399690-17399712 TAAATCTTTACTTTTTACTGTGG + Intronic
951327195 3:21316828-21316850 GATACCTTTCCCTTATACTTTGG - Intergenic
952064377 3:29550053-29550075 TAGATGTTTCCATTTTACTTTGG - Intronic
952519477 3:34142166-34142188 TAGCTCTTTCTCTTTTATTGTGG + Intergenic
952603371 3:35112265-35112287 GACTTCTTTTCCTTTTTCTGAGG + Intergenic
952847988 3:37704439-37704461 GAGAGCTTTGCCTTTGACTGGGG + Intronic
955889122 3:63631906-63631928 GTGATGTTTCCATTTTAGTGGGG - Intergenic
955954335 3:64273151-64273173 CAGATCTTTCTTTTTTCCTGTGG + Intronic
957756957 3:84502245-84502267 GAGATCTTTACATTTTATTTAGG + Intergenic
959129240 3:102332410-102332432 GAAATGTCTCCCTTTTACAGGGG + Intronic
960222181 3:115126432-115126454 GAGTTGTTTCCCTTTTATTGTGG - Intronic
961489587 3:127245248-127245270 AATGTCTTTCTCTTTTACTGGGG + Intergenic
961847764 3:129782150-129782172 GTGATCATTCCCTTGTACTCTGG - Intronic
962611892 3:137084643-137084665 GAGATCTCTTGCTTTTACTTAGG - Intergenic
963522190 3:146369165-146369187 GAGATTTTTCCATTTTTCTCGGG - Intergenic
964278291 3:155032410-155032432 GGGATTTTTACTTTTTACTGAGG - Intronic
970014156 4:11494065-11494087 GAGAACTGTCTCTTTTACTTTGG + Intergenic
970366033 4:15359283-15359305 GATGTCTTTCCCTTTTTCTGTGG - Intronic
970570011 4:17370868-17370890 TTGATCTTTCCTTTTTACTAAGG - Intergenic
970930976 4:21511495-21511517 GAGATCTTTCCAATTTTCTTTGG - Intronic
971923261 4:32971341-32971363 GAGATCATTGCATTTTAATGAGG - Intergenic
973712811 4:53646034-53646056 GGGATATTTCCCTTTTGCTTTGG + Intronic
974060607 4:57030816-57030838 CAGATCTTTGTCTTTTTCTGGGG + Exonic
974131658 4:57763549-57763571 GAGGACTTTAACTTTTACTGTGG - Intergenic
974398917 4:61375664-61375686 GAGATATTTACCGTTTACAGAGG - Intronic
978254070 4:106672560-106672582 GACATTTTCCCCTTTTACTTGGG + Intergenic
978946498 4:114505261-114505283 GAGATCTTTCATTTTTTATGTGG + Intergenic
979316665 4:119273115-119273137 GAGATCTTTCCATGTTGCTCAGG - Intronic
979875473 4:125885313-125885335 GAGATCTCTTCCTGTTCCTGAGG + Intergenic
980318040 4:131231114-131231136 CAGATATTTCCTTTTTACTATGG + Intergenic
981616954 4:146652428-146652450 GAGATCTAACTCTTTTAATGAGG + Intergenic
983998139 4:174210606-174210628 GAGAGCCTTCCCCTTTACTAGGG - Intergenic
984658780 4:182350609-182350631 GAGAATTCTACCTTTTACTGGGG - Intronic
984724542 4:183008349-183008371 GAAATCTTTCTTTTTTATTGTGG - Intergenic
985196895 4:187440812-187440834 GAAATCTTTCCATTTCCCTGAGG - Intergenic
985790079 5:1921802-1921824 GAGTTGCTTCCTTTTTACTGCGG + Intergenic
986253890 5:6085682-6085704 GAGGCCTTTACCTTTTAATGGGG - Intergenic
989320422 5:40128172-40128194 TAGATCTTTCCCACTTCCTGTGG + Intergenic
992467842 5:77024713-77024735 GAGATTCTTCCCTTTTAGTGAGG + Intergenic
994597149 5:101853996-101854018 GAGATCTGTTTCTCTTACTGTGG - Intergenic
999936249 5:156488568-156488590 GAAATATTTCTCTTTTACTTTGG - Intronic
1003615070 6:7647752-7647774 GATTGCTTTCACTTTTACTGAGG - Intergenic
1005008078 6:21310023-21310045 GCGATCTTTCCGCTTTACTGAGG + Intergenic
1006004044 6:30988525-30988547 GAGGTCTTTGGATTTTACTGTGG - Exonic
1007366828 6:41400051-41400073 GAGATCTTTTTCTTTCCCTGGGG - Intergenic
1008639016 6:53442648-53442670 GAGCTCTTACCCCTATACTGTGG + Intergenic
1009588502 6:65637293-65637315 GAGTTTTTTCCTTTTTTCTGTGG - Intronic
1010151771 6:72741089-72741111 GATGTCTTGCCCTTTTCCTGAGG + Intronic
1012028000 6:94022574-94022596 GACATATTTCCCATTTACTGAGG - Intergenic
1013722238 6:113044281-113044303 GAGACATTTCTCTCTTACTGGGG - Intergenic
1013839281 6:114371210-114371232 GAGAATTTTCCTCTTTACTGAGG + Intergenic
1015171297 6:130257127-130257149 GAGATCTTTCCCTTATTATAAGG - Intronic
1015499357 6:133916124-133916146 TAGCTCATTCCTTTTTACTGCGG - Intergenic
1016097285 6:140053900-140053922 GAAATCTTTCTCTTTTATTAAGG + Intergenic
1017559240 6:155608898-155608920 GAGGGCTTTCCCTCTTACTAGGG + Intergenic
1020176233 7:5884358-5884380 TAAATCTTTCCCTTATTCTGAGG - Intronic
1020665022 7:11030385-11030407 GAGAGCTTTCTTTTTTACTATGG + Intronic
1020836765 7:13163238-13163260 GAGATTTTTCCATAATACTGAGG + Intergenic
1022877184 7:34546133-34546155 GAGATCTTTCTTCTTTATTGAGG + Intergenic
1023212814 7:37826383-37826405 GAGATGTGTTACTTTTACTGCGG + Intronic
1025235708 7:57233430-57233452 GAGAACAGTGCCTTTTACTGGGG - Intergenic
1029082591 7:97986667-97986689 TAAATCTTTCCCTTATTCTGAGG + Intronic
1029687945 7:102161932-102161954 GAGCTGTTTTCCTTATACTGTGG - Intronic
1030994847 7:116347780-116347802 GACATCTTGCTCATTTACTGAGG - Intronic
1031155188 7:118101794-118101816 CATATCTTTGACTTTTACTGAGG - Intergenic
1031566650 7:123306441-123306463 GAAATTTTTCTCTTTTACTTAGG + Intergenic
1039511169 8:38093159-38093181 GAGTTCTTTCTCTTTTTCTAAGG + Intergenic
1041341615 8:56852170-56852192 GGGATCTTGCCCTGTTCCTGAGG - Intergenic
1042610308 8:70591683-70591705 GAGATCTTTGCCTTATATTTGGG - Intronic
1042873441 8:73418838-73418860 GACATCTCTCCCCTTTCCTGGGG - Intergenic
1043298905 8:78702840-78702862 CAGTTCTTTTGCTTTTACTGAGG + Intronic
1043403223 8:79904038-79904060 GAGATTCTTACCTTTAACTGTGG - Intergenic
1043756722 8:84012535-84012557 GCCATCTTTCCTTTTTACTGGGG + Intergenic
1044158088 8:88875629-88875651 GAGATATTACCATTTTATTGAGG + Intergenic
1047737934 8:127782889-127782911 GAGCTCTTGCCCTATTAATGAGG - Intergenic
1048837968 8:138539280-138539302 AAGATTTTTCCCTTTTACAATGG - Intergenic
1048949904 8:139487735-139487757 GAGGGCTTACACTTTTACTGGGG - Intergenic
1049760515 8:144330085-144330107 GAGGTCTGGCCCTTTTCCTGTGG - Intergenic
1053104359 9:35397493-35397515 GAGAGCTTTCTCCTGTACTGTGG + Intronic
1053332254 9:37223660-37223682 GTCATTTTTCTCTTTTACTGTGG - Intronic
1055923977 9:81491122-81491144 AACATCTTTGCCTTTTAGTGTGG - Intergenic
1056836808 9:89962093-89962115 GAGTACTTTCACTTTCACTGTGG - Intergenic
1057793243 9:98137881-98137903 GTGATTGCTCCCTTTTACTGAGG - Intronic
1059652280 9:116325933-116325955 GAGATCATTCCCCTTTGCAGTGG - Intronic
1186443595 X:9607026-9607048 CAGAGTTTTCCCTTTTACTCAGG + Intronic
1187674064 X:21698325-21698347 GATATTTTTACATTTTACTGTGG + Intergenic
1192056841 X:67781773-67781795 GAGCTCCTTCCCCATTACTGAGG + Intergenic
1192830345 X:74744703-74744725 GAGAGCTTTGCCTTTTTCTGAGG - Intronic
1192929089 X:75785705-75785727 GTGATTTTTCCCTTTTTGTGTGG + Intergenic
1194096332 X:89643866-89643888 GATATCTTTCACTTTCACTATGG - Intergenic
1194141535 X:90216006-90216028 GAGATGTTTCACTTTGACTGAGG + Intergenic
1194693945 X:97021854-97021876 GAGTACTTTCCCTTGTTCTGGGG + Intronic
1194785630 X:98081001-98081023 GAAACCTTTCTCTTTTAATGTGG + Intergenic
1197395794 X:125925154-125925176 GAGATCTTTCTTTTTTATTTGGG + Intergenic
1197983379 X:132242166-132242188 GGATCCTTTCCCTTTTACTGTGG + Intergenic
1198439664 X:136650893-136650915 GAGATCTTTCCCTTTTACTGGGG + Intronic
1198593878 X:138215093-138215115 GAGTTCTTTCAGTTTTACGGAGG + Intergenic
1198866617 X:141129948-141129970 GACATATTTCCCTTTTGCCGCGG - Intergenic
1200319468 X:155171643-155171665 GAAATCCTTCCCTTTCAGTGGGG - Intergenic
1200487287 Y:3785110-3785132 GAAATGTTTCACTTTGACTGAGG + Intergenic
1202083174 Y:21105957-21105979 GAGTACTTTCCCTTTTTGTGAGG - Intergenic