ID: 1198440357

View in Genome Browser
Species Human (GRCh38)
Location X:136657383-136657405
Sequence GACCATGACCACTGCTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198440350_1198440357 25 Left 1198440350 X:136657335-136657357 CCAAAGTAAGAGCACTGAATAGG No data
Right 1198440357 X:136657383-136657405 GACCATGACCACTGCTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198440357 Original CRISPR GACCATGACCACTGCTTGCT GGG Intronic