ID: 1198440357 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:136657383-136657405 |
| Sequence | GACCATGACCACTGCTTGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1198440350_1198440357 | 25 | Left | 1198440350 | X:136657335-136657357 | CCAAAGTAAGAGCACTGAATAGG | No data | ||
| Right | 1198440357 | X:136657383-136657405 | GACCATGACCACTGCTTGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1198440357 | Original CRISPR | GACCATGACCACTGCTTGCT GGG | Intronic | ||