ID: 1198441367

View in Genome Browser
Species Human (GRCh38)
Location X:136666612-136666634
Sequence GGGAAGGTCACTGGAAATTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 251}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198441367_1198441383 24 Left 1198441367 X:136666612-136666634 CCTCAATTTCCAGTGACCTTCCC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1198441383 X:136666659-136666681 TTTGGGGAGGGAGGGGTGAGTGG 0: 1
1: 0
2: 16
3: 221
4: 2269
1198441367_1198441377 8 Left 1198441367 X:136666612-136666634 CCTCAATTTCCAGTGACCTTCCC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1198441377 X:136666643-136666665 CAAATTTCTCTTGTCTTTTGGGG 0: 1
1: 1
2: 2
3: 55
4: 513
1198441367_1198441380 15 Left 1198441367 X:136666612-136666634 CCTCAATTTCCAGTGACCTTCCC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1198441380 X:136666650-136666672 CTCTTGTCTTTTGGGGAGGGAGG 0: 1
1: 0
2: 4
3: 44
4: 468
1198441367_1198441376 7 Left 1198441367 X:136666612-136666634 CCTCAATTTCCAGTGACCTTCCC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1198441376 X:136666642-136666664 CCAAATTTCTCTTGTCTTTTGGG 0: 1
1: 0
2: 3
3: 48
4: 463
1198441367_1198441379 12 Left 1198441367 X:136666612-136666634 CCTCAATTTCCAGTGACCTTCCC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1198441379 X:136666647-136666669 TTTCTCTTGTCTTTTGGGGAGGG 0: 1
1: 0
2: 9
3: 79
4: 1336
1198441367_1198441374 6 Left 1198441367 X:136666612-136666634 CCTCAATTTCCAGTGACCTTCCC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1198441374 X:136666641-136666663 GCCAAATTTCTCTTGTCTTTTGG 0: 1
1: 0
2: 3
3: 24
4: 289
1198441367_1198441382 17 Left 1198441367 X:136666612-136666634 CCTCAATTTCCAGTGACCTTCCC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1198441382 X:136666652-136666674 CTTGTCTTTTGGGGAGGGAGGGG 0: 1
1: 0
2: 4
3: 52
4: 543
1198441367_1198441381 16 Left 1198441367 X:136666612-136666634 CCTCAATTTCCAGTGACCTTCCC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1198441381 X:136666651-136666673 TCTTGTCTTTTGGGGAGGGAGGG 0: 1
1: 0
2: 6
3: 61
4: 1020
1198441367_1198441378 11 Left 1198441367 X:136666612-136666634 CCTCAATTTCCAGTGACCTTCCC 0: 1
1: 0
2: 2
3: 24
4: 251
Right 1198441378 X:136666646-136666668 ATTTCTCTTGTCTTTTGGGGAGG 0: 1
1: 0
2: 4
3: 39
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198441367 Original CRISPR GGGAAGGTCACTGGAAATTG AGG (reversed) Exonic
900541294 1:3204279-3204301 GGGGAGGGCAGTGGAAATTGGGG + Intronic
900967860 1:5971832-5971854 GGCAAGGTCACTGGAGACAGAGG + Intronic
901760434 1:11467694-11467716 GGGTAGTTCTTTGGAAATTGAGG + Intergenic
902336528 1:15757903-15757925 GGGAGGGTCACTGGATGTGGAGG + Intronic
902541020 1:17154836-17154858 GGAGAGGTCACTGGGATTTGGGG - Intergenic
903190755 1:21654277-21654299 GGCAAGGACAATGGACATTGAGG + Intronic
904267620 1:29326634-29326656 GGGAAGGTCTCTTTAAAATGGGG + Intronic
904749052 1:32729540-32729562 GGGAAGGCCACTGGTAGCTGTGG - Intergenic
905521372 1:38603122-38603144 GGGAAGGGCCATGGAAAATGAGG - Intergenic
905993366 1:42359479-42359501 GGGAAGGCCACAGGACAGTGTGG - Intergenic
906244440 1:44263113-44263135 GGGAAGGTTAATGGAACTTCTGG - Intronic
906726714 1:48049573-48049595 GGGAAGTTCACTTCAACTTGGGG + Intergenic
906922874 1:50083290-50083312 GGGAGGATCACTTGACATTGGGG - Intronic
908139495 1:61169519-61169541 GGTAATTGCACTGGAAATTGTGG - Intronic
908820996 1:68086531-68086553 GGGAAGGTCCCTGGCAATCTTGG + Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
915544509 1:156588908-156588930 AGGAAGCAAACTGGAAATTGCGG + Intergenic
915812011 1:158923131-158923153 GGGTAGGTGACTGCAAAGTGAGG + Intergenic
916974241 1:170058457-170058479 GGTAAGGTCATTTGGAATTGTGG - Intronic
917076879 1:171214913-171214935 GCCAAGGTCACTGGAACTTGGGG - Intergenic
917192008 1:172428024-172428046 GGGATGGTAACTGGAGATTTTGG - Intronic
918114545 1:181485033-181485055 GGCAAGGCCATTGGGAATTGGGG + Intronic
918350214 1:183647746-183647768 TGGAAGGTCAGTGGAGATAGTGG - Exonic
918477573 1:184941556-184941578 GGGAAGGTCACTTGAGCCTGGGG + Intronic
920601784 1:207333005-207333027 GGGTAATACACTGGAAATTGAGG + Intronic
920744563 1:208614418-208614440 GGGAAGTTCACTGGACATGGAGG + Intergenic
922231156 1:223687775-223687797 GGGAAGGTCAGCGAAGATTGTGG - Intergenic
1063384656 10:5608521-5608543 CGGAAGGTCTCTGGATGTTGTGG - Intergenic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1064743103 10:18453346-18453368 AGGAAGGACACTGGAAAGTCAGG - Intronic
1067164779 10:43856545-43856567 GGAAAGGGCACTAGAAGTTGGGG + Intergenic
1067391434 10:45866552-45866574 GGGAAGATCACTTGAGCTTGGGG - Intergenic
1067403253 10:45997127-45997149 GGGAAGATCACTTGAGCTTGGGG + Intronic
1067871857 10:49969599-49969621 GGGAAGATCACTTGAGCTTGGGG + Intronic
1069431229 10:68336346-68336368 GGGAAGGGAACTGGGAACTGAGG + Intronic
1070130871 10:73654534-73654556 GGGTAGGTAACTAGAAATGGTGG + Intronic
1072631949 10:97152282-97152304 GGGAAGGTCCCTGCAAATTGAGG + Intronic
1073114321 10:101082702-101082724 GTTAAGGTCACTTGATATTGAGG - Intergenic
1074868758 10:117561046-117561068 GGGAATGTTTCTGGAAATTTTGG - Intergenic
1075240713 10:120775908-120775930 GGGAAGGTGACTGGAAAGAAAGG - Intergenic
1075839970 10:125493443-125493465 GGGAAGCACACTGGAAAGTGTGG + Intergenic
1077121161 11:909295-909317 GGGAAGGTCATTGGCATTTGGGG - Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1080466249 11:32500140-32500162 TGGAAGGTCACTGGCAAATTGGG - Intergenic
1081384198 11:42452090-42452112 GTGAAGGCAACTGGAAATGGAGG + Intergenic
1084866103 11:72059041-72059063 GGGAGTGTCACTGGCAAATGTGG - Intronic
1085466013 11:76723855-76723877 GGGAAGGTGACAGGAACCTGGGG + Intergenic
1086191069 11:84079826-84079848 GGGAAGGTGACTGGAGGTGGTGG - Intronic
1086554424 11:88091926-88091948 AGGCACGTCAATGGAAATTGAGG + Intergenic
1087349839 11:97018109-97018131 TGGAATGTAACTGGAAAATGTGG + Intergenic
1087431777 11:98065044-98065066 GCCAAGGTCACTGGAACTTGGGG - Intergenic
1090079073 11:123599119-123599141 GGCAATGTCAGTGGAATTTGAGG - Intronic
1090266082 11:125353832-125353854 GGGAAGGCCAATGGCAATTTGGG - Intronic
1090502872 11:127278892-127278914 GGCATGGTTACTGGAACTTGTGG + Intergenic
1090673365 11:128967014-128967036 GAAAAGGTCTGTGGAAATTGAGG - Exonic
1091871187 12:3892585-3892607 AAGAAGGTCACTGGCTATTGAGG - Intergenic
1092658694 12:10715677-10715699 GAGAAGGTGAGAGGAAATTGTGG - Exonic
1095923906 12:47559330-47559352 AGGGAGGTCACTGGGATTTGGGG - Intergenic
1097110318 12:56653109-56653131 GGGAAGGACAGTGGAAGTTTTGG - Intergenic
1097601224 12:61695193-61695215 GTCAAGGTCACTGGGACTTGGGG + Intergenic
1099671206 12:85695419-85695441 GGGAAAGTCACTGAAAATGTGGG + Intergenic
1100378775 12:94042586-94042608 GGGCAGGTCACTGGAAAAGCTGG + Intergenic
1101487117 12:105175930-105175952 GTGATGTTCACTGGAAAGTGTGG - Intronic
1102376178 12:112423021-112423043 GGCAAGGTCTCTGGGAGTTGTGG + Intronic
1103457700 12:121079449-121079471 GGGAAGGTCACCTGAATCTGGGG + Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104785327 12:131444875-131444897 GGGGAGCTCACTGCAAGTTGAGG - Intergenic
1105620609 13:22062243-22062265 GGCAAGGCAACAGGAAATTGTGG - Intergenic
1108004113 13:45930589-45930611 CTGAAGGTCACTGGAAATCTGGG + Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109119728 13:58439408-58439430 AGGAAGCTCAATGGAAGTTGTGG + Intergenic
1109458687 13:62626571-62626593 GCCAAGGTCACTGGAACTCGGGG - Intergenic
1109465172 13:62722374-62722396 CAGAAGGTCACAGTAAATTGAGG + Intergenic
1109786615 13:67184226-67184248 GGGAACAACACTGGAAATTAAGG + Intronic
1111306266 13:86416813-86416835 GGAATGGACACTGGAGATTGTGG - Intergenic
1114772478 14:25443999-25444021 GGGAAGATAATTAGAAATTGAGG + Intergenic
1115497295 14:34018885-34018907 GAGAAGGCCACTACAAATTGTGG - Intronic
1116041256 14:39688662-39688684 GGGAAGATCAGTGGATATCGAGG - Intergenic
1116119574 14:40705512-40705534 GGGAAGGTGATTGGATCTTGGGG - Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1120717517 14:87855593-87855615 GGAAATGTAAGTGGAAATTGAGG + Intronic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1124054871 15:26233104-26233126 GGGAAGGGCAGTGGGAAGTGAGG - Intergenic
1125790424 15:42361377-42361399 GGGAAGATCACTTGAACTCGGGG + Intronic
1128224708 15:65993746-65993768 GGCAACGGCACTGGAAGTTGTGG + Intronic
1128977165 15:72162432-72162454 TGGAAGTTCACCGGAAATAGTGG + Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130262388 15:82366316-82366338 GGGATGGTCAGTGGAAACTCTGG + Intergenic
1130278841 15:82502691-82502713 GGGATGGTCAGTGGAAACTCTGG - Intergenic
1131849112 15:96518862-96518884 GGAAAGGTCAAGGAAAATTGGGG + Intergenic
1131906345 15:97147314-97147336 GGGAAAGAGACTGAAAATTGGGG + Intergenic
1132849055 16:2016042-2016064 GGAAAGGTCACTGGGAACAGAGG - Intronic
1135247774 16:20871888-20871910 GGGAAAGTCACTGGAAAAGCTGG - Intronic
1136994744 16:35181928-35181950 GGTGAGGTCACTGGAGAGTGTGG + Intergenic
1138327437 16:56187401-56187423 TGGTAGGTCACTAGAAATTTTGG - Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG + Intergenic
1139800538 16:69519109-69519131 GGGAAGGGCATTTGAAATGGAGG - Intergenic
1139945873 16:70641656-70641678 GGGAAGATCACTTGAATCTGGGG - Intronic
1141585969 16:85033881-85033903 GGGAGGGTAACTGGGAAGTGGGG - Intronic
1142934285 17:3314580-3314602 GGGGAGGGCAGTGGAAAATGGGG + Intergenic
1144261498 17:13526388-13526410 GGCCATGTCACTGGGAATTGGGG + Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146911569 17:36651647-36651669 GGGGAGGTCACAGGAAATGAGGG + Intergenic
1147455621 17:40536443-40536465 GGGAAGGTCACTGTGAGCTGAGG + Intergenic
1148961185 17:51394248-51394270 GGTAATCTCACTGGAAACTGAGG - Intergenic
1150181732 17:63129084-63129106 GGGAGGATCCCTGGAGATTGTGG - Intronic
1153769223 18:8401795-8401817 TGCAAGGGAACTGGAAATTGAGG - Intronic
1156698518 18:39796202-39796224 GCCAAGGTCACTGGAACTTGGGG - Intergenic
1159025045 18:63175982-63176004 GGGAAGGTGGGTGAAAATTGTGG + Intronic
1159665511 18:71154615-71154637 GAGAAGGGCACTGAAAATTGGGG - Intergenic
1160471577 18:79139813-79139835 GGGAAGGTTAGTGGGAGTTGTGG - Intronic
1160784308 19:892561-892583 GGGATGGACCCTGGAGATTGGGG - Intronic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1163427556 19:17247469-17247491 GGGAATGTGACTGGTAATTTGGG + Intronic
1164309251 19:24031911-24031933 GGAAGGATCACTGGAGATTGAGG - Intergenic
1164470939 19:28531544-28531566 GAAAAGTTCACTGGAACTTGAGG + Intergenic
1165214523 19:34260916-34260938 GGGACAGTGTCTGGAAATTGGGG + Intronic
1165423016 19:35731766-35731788 TGGGTGGTCACTGGAAACTGGGG + Intronic
1165445000 19:35851718-35851740 GGGAAGGTAAGTGGGAAATGGGG + Intronic
925098081 2:1223556-1223578 GGGAGGGTGCCAGGAAATTGAGG - Intronic
925546900 2:5025922-5025944 GGGAATTTCACTGGAAACTTAGG + Intergenic
925953904 2:8942151-8942173 GGCAATGTCAATGGAAATGGAGG + Intronic
926045057 2:9704090-9704112 GGGATGGTGGCTGGAAAGTGGGG + Intergenic
930370409 2:50494266-50494288 GTGAACTTCACTGGAAATTAGGG - Intronic
932011420 2:67981549-67981571 AGAAAGGTAGCTGGAAATTGTGG - Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
934538184 2:95154072-95154094 GGGAGGGTCAGTGGATATTTTGG - Intronic
935152329 2:100449310-100449332 GGGAAGGTGAAGGGAAATTAAGG - Intergenic
936407636 2:112221220-112221242 GGGGAGGTGACTGGATAATGGGG + Intronic
936631241 2:114205383-114205405 GGGAAAATCACTGGAAATGGGGG + Intergenic
937243001 2:120474557-120474579 GGGAAGTGCACAGGAAAATGTGG - Intergenic
937727695 2:125186754-125186776 GCCAAGTTCACTGGAACTTGGGG - Intergenic
938727253 2:134119981-134120003 GGGAAGGTTGCCAGAAATTGAGG + Intronic
939268240 2:139903529-139903551 GGGAGAGTCACTTGAACTTGAGG + Intergenic
940878760 2:158924644-158924666 GGGAAGGTCACTTGAGCTTGGGG - Intergenic
943983882 2:194594345-194594367 GGGTAGGGCTCTGGAAAGTGGGG - Intergenic
945917619 2:215720595-215720617 GGCAAGGTCTCTGGAATTTGAGG + Intergenic
946690763 2:222306767-222306789 GGAAAGTTGACTGGAGATTGCGG + Intergenic
948179733 2:235970313-235970335 GGGAAGGTCAGTGGCATCTGTGG - Intronic
1168827126 20:821568-821590 GGGAAGGGCACTAGACAGTGGGG + Intergenic
1172319978 20:33988827-33988849 AGAAAGGTCACTGGGAAGTGGGG + Intergenic
1172917755 20:38456283-38456305 GGGAAGGACACTTGATATTTTGG - Intergenic
1172972331 20:38882741-38882763 GGGAAGCTCAATGGAGATTAGGG + Intronic
1175423465 20:58850513-58850535 TGGAAGGTCAGTAGACATTGGGG - Intronic
1177183452 21:17768080-17768102 GGGAATCTCACTAGAAATTCAGG - Intergenic
1177834658 21:26174664-26174686 AGAAAGGTCACTGGAAATAAAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1179477926 21:41659771-41659793 GGGAAGCTCCCTGGACACTGGGG + Intergenic
1180942790 22:19670519-19670541 GAGAACATCACTGGAAAATGTGG - Intergenic
1181448765 22:23001615-23001637 GGGAAGGCCACTGGAAACTTAGG + Intergenic
1182877409 22:33704311-33704333 GGGGAACTTACTGGAAATTGGGG + Intronic
949774316 3:7614356-7614378 GGGATGGTGACTGGAAGTGGGGG - Intronic
950071441 3:10155959-10155981 TGGCAGGTCACAGAAAATTGAGG + Intergenic
950939285 3:16877076-16877098 GGGAAGGTGACTGGGAGTTTGGG - Intronic
952496194 3:33917802-33917824 GGGCAGCCCACTGTAAATTGTGG - Intergenic
954507394 3:51090385-51090407 GTGAGAGTCACTGGAAATTCTGG + Intronic
954550671 3:51479037-51479059 GAGAAGGTCACTGGAATGTGGGG - Intronic
955085755 3:55700974-55700996 GGGAAGGTCACGGAGAGTTGAGG + Intronic
955613274 3:60780017-60780039 ACCAAGGTCACTGGAACTTGGGG + Intronic
957176621 3:76819091-76819113 GGGAAGGGCAATGGAGATTTAGG + Intronic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
966209009 3:177433580-177433602 GGGTAGGTCAGTGGAAAGTGTGG + Intergenic
966855810 3:184193241-184193263 GGGAAGAGCTCTGGAAAATGAGG - Intronic
967814871 3:193790082-193790104 GAGGAGATCACTGGAAAATGGGG - Intergenic
968333116 3:197888516-197888538 GGGAATGTCAGTGGAAATGGGGG + Intergenic
968822004 4:2861235-2861257 GGGAAGGCCCCTGCATATTGGGG + Intronic
968965963 4:3769265-3769287 AGGAAGGGCAGTGGAAAGTGGGG + Intergenic
969073327 4:4557393-4557415 GTGAAGGTTCCAGGAAATTGAGG + Intergenic
969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG + Intronic
969289583 4:6230141-6230163 GGGAGGGTCAGTGGACATTCAGG + Intergenic
970056794 4:11983044-11983066 TGGAAGGGCTGTGGAAATTGGGG - Intergenic
973563501 4:52161318-52161340 GGGAAGGTAGCTGGAAAGGGAGG + Intergenic
974675094 4:65078961-65078983 GCCAAGGTCGCTGGAACTTGGGG + Intergenic
974833967 4:67224419-67224441 GGGAAGGAGACAGGAAATGGTGG - Intergenic
975643984 4:76527956-76527978 GGGAGGGTGAATGGATATTGGGG + Intronic
976988641 4:91335261-91335283 GGCAAGTTCACTGGGGATTGGGG - Intronic
979300671 4:119082943-119082965 GGTGAGGTCACTGTCAATTGAGG + Intergenic
979453354 4:120899208-120899230 GGGATGGGCACAGGAAATTCTGG - Intronic
980106638 4:128594604-128594626 TGGAAGATCACTGGAAGATGAGG - Intergenic
980733942 4:136857931-136857953 GGGCAGGTTACTGGAAATGAGGG - Intergenic
980985269 4:139689170-139689192 GGTAAGGACACTGGAGTTTGAGG - Intronic
981186642 4:141811332-141811354 GGGAAGGTCATTAGAGACTGAGG - Intergenic
983391732 4:167140717-167140739 GGGGAGGTGGCAGGAAATTGAGG - Intronic
983970380 4:173864200-173864222 GAGAATCTCACTGGATATTGAGG - Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986127387 5:4895583-4895605 AGGGAGGTCACTGGATAATGGGG + Intergenic
986532960 5:8758453-8758475 GTGAAGGTCACTGGATCATGGGG + Intergenic
990209980 5:53471911-53471933 GAGAAGGAGAGTGGAAATTGAGG - Intergenic
990550690 5:56875143-56875165 GGGGAGAGCACTGGAAATTCTGG + Exonic
990597294 5:57324392-57324414 GGGCAGGACACTGGAAAGGGAGG - Intergenic
991654659 5:68892204-68892226 GGGAAGGTCACTTGAGCCTGAGG + Intergenic
992084170 5:73263115-73263137 GGGAAGAGAAGTGGAAATTGTGG - Intergenic
992779356 5:80114027-80114049 GGGCAGGTCATTGTTAATTGAGG - Intronic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
998069186 5:139183410-139183432 TGGAAGGTCTCTGGAAACTCCGG - Intronic
998491586 5:142551650-142551672 GAGAAGGGCCCTGGAAATTATGG - Intergenic
998524433 5:142829379-142829401 GAAAAGGCCACTGGAAAATGAGG - Intronic
999860022 5:155634759-155634781 AGGAAGGTCAAGGGAATTTGGGG + Intergenic
1002946879 6:1770307-1770329 TGAAAGATCACTGGAAATTGTGG - Intronic
1003561182 6:7181993-7182015 GGGAAGGTCACAGAGAATGGCGG + Exonic
1003873326 6:10417961-10417983 GCGAAATTCACTGGAATTTGAGG + Intronic
1004738923 6:18437210-18437232 AGGAAGATCACTGGAAGCTGGGG + Intronic
1004964198 6:20829187-20829209 GTGAATTTCACTAGAAATTGAGG + Intronic
1005354159 6:24966678-24966700 GGGAAGGACAATGGAGAGTGAGG + Intronic
1007310308 6:40940094-40940116 GGGGAGGTCACTACAACTTGTGG + Intergenic
1007362757 6:41370626-41370648 GGGAGGGTCAATGGAAAGTCAGG - Intergenic
1007576955 6:42931302-42931324 GGGTGGGTCACTGGAGGTTGCGG - Intronic
1007682791 6:43645706-43645728 GGGAAGGTTTCTGGAAAATGCGG + Intronic
1007962850 6:45976432-45976454 GGGAAGGTCCCTGGAAAACTGGG + Intronic
1008266011 6:49427024-49427046 TGGAAGGTGACTGGATCTTGGGG + Intergenic
1010360504 6:74987553-74987575 TGGAAGGTGACTGGAACATGGGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011508943 6:88078899-88078921 GGGAAGGGCACTGGACTTTTAGG - Intergenic
1013511669 6:110850362-110850384 GGGAGGGTCAAGGGAATTTGGGG - Intronic
1015417865 6:132970175-132970197 GGAAAGGTCACAGGTAATTTTGG - Intergenic
1016162061 6:140894460-140894482 GCCAAGGTCACTGGAACTCGGGG - Intergenic
1016488651 6:144571794-144571816 TGTCAGGTCACTGGAAAATGTGG - Intronic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1016779048 6:147938409-147938431 GGGATGCTCAATGGAAATTATGG + Intergenic
1017457746 6:154617540-154617562 GGAAAGCTCACTGGAAAAAGCGG - Intergenic
1018910124 6:168096960-168096982 GGGAAGCTCCCTGGAGAGTGGGG + Intergenic
1019125680 6:169838817-169838839 GGGAAGGTCACTGGGAGATTTGG + Intergenic
1020522988 7:9218152-9218174 GAGAAGTTCATTGGAATTTGAGG + Intergenic
1020563190 7:9758126-9758148 GTGAAAGTCACTGGAGACTGAGG + Intergenic
1022704567 7:32790255-32790277 GGGAAGGTCCCTGGCTCTTGAGG + Intergenic
1024348080 7:48333855-48333877 GGCCAGGTCACTTGATATTGTGG + Intronic
1027425546 7:78058350-78058372 GGGAAGGGCACGGAAAAGTGGGG - Intronic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1029637154 7:101792644-101792666 GGGAAGTTTTCAGGAAATTGTGG + Intergenic
1032401027 7:131624503-131624525 GGGAAGGCCACTCTAAAGTGTGG + Intergenic
1032908555 7:136402304-136402326 GTGAAGGTCACTGGAAAAGTTGG + Intergenic
1035105059 7:156435180-156435202 GGGAAGGTCACTGCAAAGGCAGG + Intergenic
1035191651 7:157174542-157174564 GGGAGGATCACTTGAACTTGCGG - Intronic
1035432385 7:158831702-158831724 TGAAAGGTCACAGGAGATTGAGG - Intergenic
1037888704 8:22609631-22609653 GAGAAGGTCCCTAGAAACTGAGG - Intronic
1038253665 8:25929913-25929935 GGGAAGGACAATGGAGAATGAGG + Intronic
1038321399 8:26530708-26530730 TGGAAAGTCACTGGAGAATGTGG + Intronic
1039385746 8:37134223-37134245 GGGGAGGTCACTGGAACATGGGG - Intergenic
1040062548 8:43116354-43116376 GGGAGGATCACTGGAGTTTGAGG - Intronic
1041670591 8:60487849-60487871 GGGAAGGACAAGGGAATTTGGGG + Intergenic
1041790655 8:61693065-61693087 GGGAAAGTCACTGGAGGTGGTGG - Intronic
1043850939 8:85215876-85215898 GTGATTGTCACTGGAAGTTGGGG + Intronic
1043993707 8:86787365-86787387 GTGAAGGACAGTGGAAGTTGAGG + Intergenic
1044547441 8:93475585-93475607 GGTACGGGCACTGGAAAGTGGGG - Intergenic
1047352931 8:124093217-124093239 GGGAAGGTGACTGGATCATGGGG - Intronic
1048716414 8:137275559-137275581 GGGAAGATTTCTGGAAAATGTGG - Intergenic
1049164824 8:141119268-141119290 GGGAAGGGCACTGGCACTGGAGG - Intronic
1050698518 9:8307990-8308012 GGGAAGATCACTTGAGTTTGAGG + Intergenic
1051296961 9:15606868-15606890 ATTAAGGACACTGGAAATTGAGG - Intronic
1052995904 9:34551608-34551630 GGGGAGGGGACTGAAAATTGTGG + Exonic
1053237625 9:36469884-36469906 GGGAGGGTCACTGGAGCCTGGGG + Intronic
1055295098 9:74826028-74826050 GGGAGGGACTCTGGGAATTGTGG - Intronic
1057847446 9:98536620-98536642 GTGCAGGTCACTGGAATTTAGGG - Intronic
1059440724 9:114305348-114305370 GGGGAGGTCAGTGGAAAGAGAGG + Intronic
1059678690 9:116565558-116565580 GGGAAGATCACTTGAGCTTGGGG - Intronic
1060010275 9:120037694-120037716 GGAAAGTTCACAGGAAAATGGGG + Intergenic
1061988274 9:134143061-134143083 GGGAAGGGCACTGGGAGTGGTGG + Intronic
1186409647 X:9335573-9335595 GGAAATGTAACTGGATATTGCGG - Intergenic
1186841907 X:13493059-13493081 GGGAGGATCACTTGAAACTGGGG - Intergenic
1190286739 X:48966480-48966502 GGGAGGCTCACTACAAATTGTGG - Intronic
1190292395 X:49001465-49001487 GGGAAGATCACTGGGCTTTGGGG - Intronic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1192579642 X:72270481-72270503 GGGAAGATCACTGGAGCCTGGGG - Intronic
1193899872 X:87164123-87164145 GGGAAGGACACTAGTAAATGGGG - Intergenic
1194066396 X:89267175-89267197 GCCAAGGTCACTGGAACTCGGGG - Intergenic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1194663152 X:96648197-96648219 GGGAATTTCCCTGGCAATTGAGG - Intergenic
1195003156 X:100661839-100661861 GAGAAGGTCACTGGGATTTAGGG - Intronic
1195346943 X:103960290-103960312 GGGAAGGTGAATGGAAGTGGAGG + Intronic
1195360499 X:104078551-104078573 GGGAAGGTGAATGGAAGTGGAGG - Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1198223487 X:134624208-134624230 GGGAAGCCCACTGGAAAAAGTGG - Intronic
1198441367 X:136666612-136666634 GGGAAGGTCACTGGAAATTGAGG - Exonic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1200720565 Y:6601296-6601318 GCCAAGGTCACTGGAACTCGGGG - Intergenic