ID: 1198442732

View in Genome Browser
Species Human (GRCh38)
Location X:136679753-136679775
Sequence AGCAAAGACAGCCATAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 452}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198442726_1198442732 26 Left 1198442726 X:136679704-136679726 CCCGACCTTGTGCCACACAGTGA 0: 1
1: 0
2: 0
3: 25
4: 190
Right 1198442732 X:136679753-136679775 AGCAAAGACAGCCATAGAAAGGG 0: 1
1: 0
2: 4
3: 30
4: 452
1198442729_1198442732 14 Left 1198442729 X:136679716-136679738 CCACACAGTGAGAGAACAACAAT 0: 1
1: 0
2: 0
3: 40
4: 188
Right 1198442732 X:136679753-136679775 AGCAAAGACAGCCATAGAAAGGG 0: 1
1: 0
2: 4
3: 30
4: 452
1198442728_1198442732 21 Left 1198442728 X:136679709-136679731 CCTTGTGCCACACAGTGAGAGAA 0: 1
1: 0
2: 4
3: 25
4: 300
Right 1198442732 X:136679753-136679775 AGCAAAGACAGCCATAGAAAGGG 0: 1
1: 0
2: 4
3: 30
4: 452
1198442727_1198442732 25 Left 1198442727 X:136679705-136679727 CCGACCTTGTGCCACACAGTGAG 0: 1
1: 0
2: 2
3: 52
4: 567
Right 1198442732 X:136679753-136679775 AGCAAAGACAGCCATAGAAAGGG 0: 1
1: 0
2: 4
3: 30
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198442732 Original CRISPR AGCAAAGACAGCCATAGAAA GGG Intronic
900662040 1:3789614-3789636 GGCAAAGACTGTCAGAGAAAGGG + Intronic
900695513 1:4007087-4007109 AGCAGAGACAGACAGAAAAAGGG + Intergenic
904290304 1:29481044-29481066 AGGAAGGACAGCCTTGGAAAGGG + Intergenic
904930981 1:34087278-34087300 AGCAATCACAGCCATAAAAAAGG + Intronic
908143331 1:61210800-61210822 AGCCAAGAGAGCCAAGGAAAGGG - Intronic
908844522 1:68311316-68311338 AGCAACCACAGCCAATGAAATGG - Intergenic
909075957 1:71051042-71051064 AGAAAAGGCATTCATAGAAAGGG - Intergenic
909402285 1:75247552-75247574 AGTAAATACAGACTTAGAAAAGG + Intronic
910161016 1:84272198-84272220 AGAAAAAACCCCCATAGAAATGG - Intergenic
910242847 1:85106319-85106341 TGCAAAGACAACCACAGAATAGG + Intronic
910498820 1:87864951-87864973 AGAAAAGACAGCATGAGAAAAGG - Intergenic
910647367 1:89527869-89527891 AGGAAAGGCAGTCATAGAACAGG - Intronic
910857926 1:91714669-91714691 AGCAAAGCCAGGCATAGATTTGG + Intronic
911097620 1:94067949-94067971 TGCAAAAACAGTCATAAAAATGG - Intronic
911819318 1:102396842-102396864 TTCAAAGACAGGAATAGAAAAGG + Intergenic
911905596 1:103564735-103564757 AGCAATGACAGTCTAAGAAATGG - Intronic
912797821 1:112703544-112703566 AGCAAAGACAGGGGTAGGAATGG + Intronic
912922157 1:113879604-113879626 AGCAAACACAGCTGTAGATAGGG - Intronic
913105360 1:115609354-115609376 AGCAATGACTGGCATAAAAAGGG + Intergenic
913302958 1:117392460-117392482 ACCACGGACAGCTATAGAAAAGG - Intronic
913352508 1:117876509-117876531 ATCAAAGAGAGGCATAAAAATGG - Intronic
914918699 1:151833409-151833431 AGCAAAGAGAGACAGAGAGATGG - Intergenic
915278177 1:154804011-154804033 AGCAATGACAGCAATCAAAAGGG - Intronic
917281156 1:173379185-173379207 TACAATGACAGCCAAAGAAAGGG + Intergenic
918138990 1:181704227-181704249 AGCAAACACAGCCCCAGAGAAGG - Intronic
918724818 1:187906875-187906897 AGAAAAGACAGCACTTGAAAAGG + Intergenic
919349879 1:196436434-196436456 GGCAAAGACAGCTTTAGAACTGG + Intronic
921588385 1:216975324-216975346 ATCAAGGACAGACATGGAAAGGG + Intronic
921899623 1:220436577-220436599 AGCAAGCACAAGCATAGAAAAGG + Intergenic
922792899 1:228319970-228319992 AGCAAAGACAGATGTATAAATGG - Intronic
924877585 1:248122203-248122225 GGCACAGCCAGCCATAGAAATGG - Intergenic
924879571 1:248145419-248145441 GGCACAACCAGCCATAGAAATGG - Exonic
924884828 1:248203339-248203361 GGCACAACCAGCCATAGAAATGG - Exonic
924894746 1:248324275-248324297 GGCACAGCCAGCCATAGAAATGG + Exonic
1062993355 10:1841511-1841533 AGCAGAAGCAGCCACAGAAAGGG + Intergenic
1063129647 10:3167222-3167244 AGGAAAGACAGACCTAAAAAAGG + Intronic
1063165582 10:3459040-3459062 AGCAGAGAAAGCCACAGGAAGGG - Intergenic
1064097406 10:12434148-12434170 AGGTAAGAAAGCAATAGAAAAGG - Intronic
1064704408 10:18056873-18056895 AGCAGACACAGCCATATATAGGG + Intergenic
1065269019 10:24007642-24007664 CACAAAGACAGGCATATAAATGG - Intronic
1066279769 10:33904848-33904870 AGAAAAGACAGCCACCGACAGGG - Intergenic
1066620255 10:37342008-37342030 AACAACGACAGTCAAAGAAAAGG - Intronic
1066827731 10:39626077-39626099 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066842673 10:39948172-39948194 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066843498 10:39964464-39964486 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066849958 10:40092107-40092129 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066866621 10:40423518-40423540 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066867421 10:40439136-40439158 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066869451 10:40479546-40479568 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066876395 10:40617116-40617138 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066876655 10:40622208-40622230 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066882179 10:40730878-40730900 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066895038 10:40985343-40985365 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066900577 10:41095028-41095050 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1066911088 10:41300861-41300883 TTCAAAGACAGTGATAGAAAAGG + Intergenic
1067154837 10:43771324-43771346 AGCAAAAACAGACATAAAATGGG + Intergenic
1067225002 10:44369935-44369957 ATCAAAGACACTCAGAGAAAAGG + Intergenic
1067377890 10:45744539-45744561 AGCAAAGAAAGGCTGAGAAATGG - Intronic
1067522579 10:47019425-47019447 TGACAAGGCAGCCATAGAAAGGG + Intergenic
1067885590 10:50085216-50085238 AGCAAAGAAAGGCTGAGAAATGG - Intronic
1068054426 10:51993895-51993917 AGTAAAGAAAGCCCTAGGAAAGG - Intronic
1068189352 10:53630220-53630242 GGCAAATAAAGTCATAGAAATGG - Intergenic
1068695791 10:59966982-59967004 AGGAGAGACAGGTATAGAAAAGG + Intergenic
1068699572 10:60005385-60005407 AGCAAAGAGAGCCATTAGAAGGG - Intergenic
1069235203 10:66062753-66062775 AGCAAAGGCATCCACAGAACAGG - Intronic
1069288475 10:66746129-66746151 ACCGAAGACAGCCAGAGAGATGG - Intronic
1069610993 10:69772445-69772467 AGCACAGACAGCCATGGGGATGG - Intergenic
1069964791 10:72105428-72105450 AGCACAGAGAGCCAAATAAATGG + Intronic
1070517791 10:77224441-77224463 TGTAAAGACTGTCATAGAAAAGG - Intronic
1071812935 10:89203380-89203402 AGAAAAGAAAGCCAAGGAAATGG + Intergenic
1072455702 10:95573854-95573876 AACTAAGACAAGCATAGAAAAGG + Intergenic
1072850545 10:98886536-98886558 AGGAAAGAGTGCCATAGAGAAGG + Intronic
1072865157 10:99051524-99051546 AGAAGAAAAAGCCATAGAAAAGG + Intronic
1073490912 10:103852734-103852756 GGGAAAGAAAGCAATAGAAAGGG - Intronic
1074205331 10:111278002-111278024 GGGAAAGACAGACAAAGAAATGG + Intergenic
1074674497 10:115832753-115832775 AGCAAGGACAGCAAAAGTAAAGG - Intronic
1074777175 10:116775034-116775056 AGCAGAGACAGCCACAGGATGGG - Intergenic
1076166736 10:128288185-128288207 AGCAAAGAGAGCTAAACAAATGG - Intergenic
1076558470 10:131345627-131345649 AGCAAAGAAAGGAAAAGAAAAGG + Intergenic
1077475124 11:2783931-2783953 TGAAAAGACAGCCACAGAATGGG - Intronic
1077737172 11:4803742-4803764 ATCAAAGCCAGCCACAGAGAAGG + Exonic
1077925035 11:6673133-6673155 AGAACAAACAGCCATAGAAAAGG - Intergenic
1077990553 11:7406977-7406999 AGAAAAGACATACATACAAATGG - Intronic
1078361686 11:10674352-10674374 AGCAAAGACATTCAAATAAACGG + Intronic
1080133661 11:28827380-28827402 AGAAGACACATCCATAGAAAAGG - Intergenic
1080208872 11:29762007-29762029 AACAGAGACAATCATAGAAAAGG + Intergenic
1080232554 11:30034321-30034343 AGCAAAGACACACACAGAGAAGG + Intergenic
1080701600 11:34649196-34649218 ATCAGAGACAGCCAGGGAAAAGG - Intronic
1080797628 11:35580190-35580212 AGCCAAGACAGCCCTATTAAAGG + Intergenic
1080816649 11:35764244-35764266 ATCAAAGAAAGCAAAAGAAAAGG - Intronic
1081212826 11:40357175-40357197 ACCAAAGTCAGCCAAAGATAGGG + Intronic
1082777270 11:57255963-57255985 TGCAAAGACATGCAAAGAAATGG + Intergenic
1082800311 11:57409545-57409567 AGAAAAGACAGGCATGTAAATGG + Intronic
1082863813 11:57880057-57880079 GACAAATACAGACATAGAAATGG + Intergenic
1082880443 11:58031711-58031733 AGAAAAGAGTGCCATAGAAGAGG - Exonic
1083170393 11:60920920-60920942 AGCAAAGAAGGCCACAGAAATGG - Exonic
1083225582 11:61282485-61282507 AGCAAAGGCAGCCAAGAAAATGG + Intronic
1084431318 11:69112994-69113016 AGCAAAAACAGCAATAAAACAGG + Intergenic
1086225378 11:84502030-84502052 AGAAAAGAAAGGCAAAGAAAAGG - Intronic
1086509363 11:87540301-87540323 AGCAAATACAATCATTGAAAGGG - Intergenic
1086595401 11:88564910-88564932 AACAAAGACAGCACTATAAACGG - Intronic
1086988437 11:93275846-93275868 AGCAGAGTCAGCCATAGAGTAGG + Intergenic
1088074472 11:105829825-105829847 AGGAAAGACAGGCATAGGGAGGG + Intronic
1088468151 11:110164236-110164258 AGAAGAGACAACGATAGAAATGG - Intronic
1088761504 11:112933360-112933382 AGCATAGACAGCCAGAAAATAGG + Intergenic
1088768386 11:113008314-113008336 AAGGAAGAAAGCCATAGAAATGG - Intronic
1089108748 11:116037226-116037248 AGTAAAAACAGCCATCAAAAAGG + Intergenic
1089622684 11:119730575-119730597 GGGGAAGACAGACATAGAAACGG + Intergenic
1090167119 11:124561348-124561370 ACCAGAGACAGCAAGAGAAAGGG - Intergenic
1090761718 11:129842851-129842873 AGTAAAGATACCCATAGAATGGG + Intronic
1091554391 12:1561279-1561301 AGCAAAGAGTGCCACAGAAAAGG - Intronic
1091575427 12:1729397-1729419 AGGAATGATAGCCATAGGAAGGG + Intronic
1093292325 12:17343042-17343064 AGCAAAGTAAGTCATATAAAAGG - Intergenic
1093391334 12:18627373-18627395 AGCAATGACGCCCAAAGAAAGGG - Intronic
1094649949 12:32366024-32366046 AACAAAGACCACCATATAAAAGG + Intronic
1094774369 12:33706884-33706906 ACCAAAGAAAAGCATAGAAATGG + Intergenic
1095870413 12:47020474-47020496 AGGAAAGACAGCCAGATAACAGG + Intergenic
1096403884 12:51328791-51328813 GGCAAAGACAGACCTTGAAATGG + Intronic
1096851731 12:54443386-54443408 AGTAAAGCAAGCCCTAGAAATGG + Intergenic
1098050969 12:66452256-66452278 AGCACAGGCAGCCAGGGAAAGGG + Intronic
1098104834 12:67058718-67058740 AGCAAAGAAAGAAATAGAAATGG - Intergenic
1099318466 12:81114522-81114544 AACAAAGACAACCATTGACAGGG - Intronic
1101316129 12:103630645-103630667 AGAAGAGAGAACCATAGAAATGG + Intronic
1101409283 12:104456135-104456157 AGCCAAGCCAGCCATAGCACTGG - Intronic
1101509247 12:105377936-105377958 AGCACAGATTCCCATAGAAATGG + Intronic
1101642816 12:106600883-106600905 AGAAAATAAAGCCATAGAATGGG - Intronic
1101883199 12:108639875-108639897 AGCAAAAGCAGCCACAGACAAGG + Intergenic
1102763715 12:115412636-115412658 ATCAAAGACAGCCAAGGCAAGGG + Intergenic
1102780583 12:115561240-115561262 AGCAAAGCAAGAGATAGAAAGGG + Intergenic
1103038692 12:117677092-117677114 ATCAAAGGCATCCAGAGAAAAGG + Intronic
1105625790 13:22111170-22111192 AAGAAAGACACCCAGAGAAAGGG - Intergenic
1105833060 13:24182708-24182730 AAAAAAGACAGCCATTGATATGG - Intronic
1106110781 13:26774873-26774895 AGCAAAGCCTGGCATAGAATAGG + Intergenic
1106112299 13:26787551-26787573 AGCAATGGCAGCCACAGAAGGGG - Intergenic
1106589915 13:31090243-31090265 AGCAAACAGAGGCATAGAGAAGG + Intergenic
1106804178 13:33289309-33289331 ACCAAAGACAGCAAAAGAGAAGG + Intronic
1107279748 13:38720073-38720095 AGCAAAGAAGGTCATCGAAAGGG + Intronic
1108032957 13:46256087-46256109 AGCAAAGTCAAAAATAGAAATGG + Intronic
1108497741 13:51041986-51042008 AGCACAGACAGCCACAAAAATGG + Intergenic
1109054865 13:57534280-57534302 AGCAGAGACAGCCCTAGAGATGG + Intergenic
1110651733 13:77950222-77950244 AGCCAAATCAGACATAGAAAAGG + Intergenic
1110965826 13:81695730-81695752 AGAAAAGACAGGTAGAGAAAAGG + Intergenic
1111351152 13:87033367-87033389 AGAAAATACAGGCATAGGAAAGG - Intergenic
1114411732 14:22507023-22507045 AGAAGAGACAGGCATGGAAAAGG - Intergenic
1116777452 14:49197199-49197221 AGCAGAGACAGCAATAAAACAGG + Intergenic
1117007198 14:51432888-51432910 AGCAAAGCCAGCAACAGAAATGG - Intergenic
1117068763 14:52036921-52036943 TGAAAACACAGCCATAGAATGGG - Intronic
1117617560 14:57549061-57549083 AGTAAAAACAGCCATAGAGCTGG + Intergenic
1117989308 14:61418096-61418118 AGTAAACACAGCCACAGAACAGG - Intronic
1118464559 14:66019172-66019194 AGCAAATACAGCCCTAGGCAAGG + Intergenic
1119416383 14:74472869-74472891 AGCAAAGACAGAGAAAGAAGTGG + Intergenic
1119853565 14:77883227-77883249 GGGAAAGAAAGCCTTAGAAAAGG + Intronic
1120175341 14:81287882-81287904 ATCTAAGACAGCCCAAGAAACGG - Intronic
1120672792 14:87383718-87383740 AGCAAAGAAAGGAAGAGAAAAGG - Intergenic
1122503522 14:102217413-102217435 AGAAAAGCCACCCAGAGAAAAGG - Intronic
1125168186 15:36736190-36736212 AGCAAAAACAGAGAGAGAAATGG - Intronic
1125341261 15:38677806-38677828 GGCCAAGACAGCCATGGAGAAGG - Intergenic
1125442453 15:39717587-39717609 AGCAAACACTCCCATTGAAAAGG - Intronic
1125729831 15:41886862-41886884 TGCAAGGACAGGCACAGAAAAGG - Intronic
1126584159 15:50266624-50266646 AACAAAAAAAGCCTTAGAAATGG - Intergenic
1126813030 15:52427762-52427784 AGAAAAAATAGCCAGAGAAAAGG + Intronic
1127047983 15:55047859-55047881 AGCAAAGGAAGACATACAAATGG - Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1127675447 15:61233717-61233739 AGGAAATATAGGCATAGAAATGG - Intergenic
1128342577 15:66832914-66832936 TGCAAAAGCAGCCATAGATAAGG + Intergenic
1129076896 15:73004816-73004838 AAGAAAGACAACCATAGAAGTGG + Intergenic
1130081902 15:80741133-80741155 AGCCAAGACATACATATAAAAGG - Intronic
1130640891 15:85673999-85674021 TAAAAATACAGCCATAGAAAGGG - Intronic
1132178948 15:99736973-99736995 ATCAAAGACATACACAGAAAAGG + Intergenic
1132223430 15:100122690-100122712 AGTAAAGTCAGCTAGAGAAAAGG + Intronic
1132706433 16:1245492-1245514 AGCAAGGGAAGCCAGAGAAACGG - Intergenic
1134085100 16:11350987-11351009 AGCAAACACAGGCAAAGCAAGGG - Exonic
1134747477 16:16599404-16599426 AGCAGCGGCAGCCACAGAAAAGG + Intergenic
1135100072 16:19597454-19597476 AGCCAAGAAACCGATAGAAATGG + Intronic
1135191058 16:20355087-20355109 AGCAAAGAGAGCAAGGGAAAAGG - Intronic
1135622052 16:23964362-23964384 CGCAAAGGCAGCCATAGATAAGG - Intronic
1135756102 16:25099785-25099807 AGGAAGGACAGCCACAGAGAAGG + Intergenic
1136015418 16:27397024-27397046 TGAAAAGACAGCCACAGAATGGG + Intergenic
1136072723 16:27797979-27798001 AGCACATACGGCCATAGAAAGGG + Intronic
1136679890 16:31953195-31953217 AGTAAAGACAGCCACAGACTTGG - Intergenic
1136780235 16:32894739-32894761 AGTAAAGACAGCCACAGACTTGG - Intergenic
1136890171 16:33964906-33964928 AGTAAAGACAGCCACAGACTTGG + Intergenic
1136924580 16:34359968-34359990 AGCAAAGGCAACTATACAAAGGG + Intergenic
1136979993 16:35051838-35051860 AGCAAAGGCAACTATACAAAGGG - Intergenic
1138222383 16:55263672-55263694 TGCAGAGACAGCCATACAGAGGG - Intergenic
1138845582 16:60561488-60561510 CTCAAAAACAGACATAGAAATGG - Intergenic
1139486867 16:67262750-67262772 AGGAAAGAGAGCCAAAGACAAGG + Intronic
1139699781 16:68700966-68700988 AGCAAAGACAGCCCTGGCAGAGG - Intronic
1140185452 16:72765811-72765833 TAGAAAGACAGCCAAAGAAAAGG - Intergenic
1140599288 16:76455995-76456017 AACAAAGAGAGCAACAGAAAGGG + Intronic
1203082861 16_KI270728v1_random:1158708-1158730 AGTAAAGACAGCCACAGACTTGG - Intergenic
1142957152 17:3529865-3529887 AGCAGAGTCAGGCACAGAAAAGG - Intronic
1144275824 17:13667318-13667340 ACCAAAGACAGTTATAGAACAGG + Intergenic
1147656683 17:42095188-42095210 AGCAGAGACAGCCACAATAAAGG + Intergenic
1149282583 17:55124676-55124698 AGCAAATACAGCAATAAAAATGG - Intronic
1150758694 17:67940100-67940122 AGAAAAGGCAGCCTTATAAATGG + Intronic
1150908370 17:69362423-69362445 AGGACAGACTGCCTTAGAAATGG + Intergenic
1151288106 17:73128146-73128168 AGCAAAGGCTGCCATACCAAAGG + Intergenic
1153199829 18:2636512-2636534 TGCATAGAAGGCCATAGAAAAGG + Intergenic
1153933574 18:9900780-9900802 AGCAAAGGAAGCAAAAGAAACGG + Intergenic
1154071975 18:11161091-11161113 AACAAACACTGCAATAGAAAAGG + Intergenic
1155266262 18:24097274-24097296 AGCAAAGACAGCAAGAGCAAAGG - Intronic
1155565905 18:27133787-27133809 AGAAAAGTCAGCCATGGAAATGG + Intronic
1155857920 18:30857763-30857785 AGAAAAGCCAGGCATAGAAGAGG - Intergenic
1156919703 18:42506105-42506127 AGAGAAGACAGACACAGAAAGGG + Intergenic
1156930117 18:42631570-42631592 AACAAAGACAGACATAGGTAAGG + Intergenic
1156965520 18:43086690-43086712 TGCAAAGGGAGCCACAGAAAGGG + Intronic
1157509195 18:48256580-48256602 AGCAATGATAGCTTTAGAAATGG + Intronic
1158912934 18:62085917-62085939 ACCATAGACACCCACAGAAATGG + Intronic
1158960219 18:62582027-62582049 AGGAGATACAGCCATAGTAAAGG + Intronic
1159637924 18:70827863-70827885 AGCAGAGGCAGGCATGGAAATGG - Intergenic
1159872095 18:73769892-73769914 ATCAAATACAGCAACAGAAAAGG - Intergenic
1161402422 19:4073336-4073358 AGAAAAGCAAGCCATAGGAATGG + Intergenic
1162121704 19:8473927-8473949 AGCAAAAAGAGGCATAGAGATGG - Intronic
1162248037 19:9419249-9419271 AGAAAAGACAGAAGTAGAAAGGG - Exonic
1163035783 19:14568005-14568027 AGGTAAGGCAGCCATAGAGATGG - Intronic
1164254681 19:23517202-23517224 AGCCAAACCAGACATAGAAAAGG + Intergenic
1164274279 19:23702952-23702974 AGCCAAATCAGACATAGAAAAGG - Intergenic
1164295977 19:23910292-23910314 AGCCAAACCAGACATAGAAAAGG - Intergenic
1165654369 19:37520444-37520466 AGCAAAGACTCCCACATAAAAGG + Intronic
1165979759 19:39710392-39710414 AGCAAAGAAAGCCTTCCAAAAGG + Intergenic
1166305225 19:41933685-41933707 AGCAGAGACACCCTAAGAAAGGG + Intergenic
1166425811 19:42676688-42676710 AGTAAACAGAGCCATAGAAATGG - Intronic
1166936993 19:46339912-46339934 AGCCAAGAGAGGCAGAGAAAGGG - Exonic
1167238990 19:48332113-48332135 AACAAAGACAGTCATAGAAGAGG - Intergenic
1167424273 19:49422061-49422083 AGGAAAGAGACCCAGAGAAAGGG + Intergenic
925405623 2:3603955-3603977 AGCATAGCCAGCCACAGACATGG - Intronic
925734953 2:6955780-6955802 ACAAAAGACAGCCATTAAAATGG - Intronic
925817840 2:7770690-7770712 AAAAAAAACAGCCATGGAAAAGG + Intergenic
926129623 2:10294077-10294099 AGCACAGGCAACCAAAGAAAAGG - Intergenic
926360627 2:12083242-12083264 TTCAAAGCCTGCCATAGAAATGG - Intergenic
926608054 2:14917404-14917426 ATCAAAGCCAGCCAGAGACAGGG + Intergenic
926834392 2:17001571-17001593 ACCAATGACAGCCTTATAAAAGG + Intergenic
927290676 2:21402080-21402102 TGCCAAGACAGACATAGAGATGG + Intergenic
927690948 2:25207715-25207737 AGCAAAGCCAACCACAGCAAAGG - Intergenic
928008948 2:27589594-27589616 AGCAAAGTAAACCAAAGAAAAGG - Intronic
928273030 2:29874210-29874232 AGAGAAGAAAGCCATAGAGAAGG - Intronic
928609158 2:32975285-32975307 ATTAAAGACAGCCAGAGAGAAGG - Intronic
928734845 2:34276250-34276272 AGCAAAAACTGCTAAAGAAAGGG + Intergenic
929383721 2:41381219-41381241 AGCAAAGAGAGGCATGGACAAGG - Intergenic
929877002 2:45805211-45805233 AGAAAACAGAGCCATAGAGAGGG + Intronic
930235683 2:48886910-48886932 AGCAAGAACAGGCCTAGAAATGG - Intergenic
930323909 2:49888836-49888858 AAAAAAGGCAGCCAGAGAAAAGG - Intergenic
931099970 2:58987021-58987043 AGCAAAAACAAGTATAGAAAAGG + Intergenic
931123404 2:59246109-59246131 AGCAAATAGAGCCAAACAAAAGG - Intergenic
932484501 2:72075328-72075350 AGCAAATGCAGATATAGAAAGGG + Intergenic
932603920 2:73151060-73151082 AGCAAAGACAGACAGGGAGATGG + Intronic
933636136 2:84710917-84710939 TGCAATGATAGCCAAAGAAATGG - Intronic
934715143 2:96538666-96538688 AACAAAGACAGCCTTTGAAGCGG - Intronic
934969798 2:98754014-98754036 AGCCAAATCAGACATAGAAAAGG - Intergenic
935563138 2:104578797-104578819 AGCTAAGACAGTCAGGGAAAGGG + Intergenic
935978167 2:108599969-108599991 AGAAAAGACAACCACAGAATGGG - Intronic
937669540 2:124523547-124523569 AGCAAAGACAGCTGGAGCAATGG + Intronic
937953297 2:127404861-127404883 AACAAAGACAGCCCCAGAAGAGG - Intergenic
938700166 2:133870602-133870624 TGAAAAGACAGCCAAAGAATGGG + Intergenic
938993443 2:136653266-136653288 AGAGAAGACAGACATACAAATGG + Intergenic
939578982 2:143925976-143925998 AGAGAAGACAGCCATTCAAAAGG - Intergenic
942328874 2:174800649-174800671 AGCAAAGACAGCCAGAGTGAAGG - Intronic
942735965 2:179112934-179112956 AGAAAAGAAAGACACAGAAATGG + Intronic
943400805 2:187408623-187408645 AACAAAACCAGCCATAGAAGGGG - Intronic
943467217 2:188242783-188242805 AGCAAAAACAACCATCAAAAAGG + Intergenic
944135101 2:196390533-196390555 AGCAAAGACAGGCACAGAAAAGG - Intronic
944306651 2:198187178-198187200 ACCAAAGACCACCATAGAGAAGG - Intronic
944607072 2:201361662-201361684 GGTAAAAACAGCCATAGAAGTGG + Intergenic
944980786 2:205117555-205117577 AACAGGGTCAGCCATAGAAAAGG - Intronic
944996883 2:205303880-205303902 AGTAAAGACAGTAATAGAAAGGG - Intronic
945276583 2:207993650-207993672 AGAAAATACAGGCATAGGAATGG + Intronic
945910029 2:215637796-215637818 AGAAAAAAGAGTCATAGAAAGGG + Intergenic
946298380 2:218805272-218805294 GACAGAGACAGACATAGAAAGGG - Intronic
946424465 2:219585802-219585824 AGCCAATTCAGACATAGAAAAGG + Intergenic
946547704 2:220763172-220763194 TGCAAAGACAGCAAAAGGAATGG - Intergenic
946548872 2:220778130-220778152 AGAAAAGACAAGCACAGAAATGG + Intergenic
947234777 2:227929315-227929337 AGAAAAGGCAACCATAGAATGGG - Intergenic
947853172 2:233305124-233305146 AACAAACAATGCCATAGAAATGG - Intergenic
948170211 2:235895368-235895390 AACAAAGACAGCGATAGAGCAGG - Intronic
1169054667 20:2610799-2610821 AAAAAAGACAACCAGAGAAAAGG - Intronic
1169961298 20:11162991-11163013 ATCAAAGACAGAAAAAGAAAGGG - Intergenic
1170231057 20:14047143-14047165 AACAAAGAAATCCATGGAAATGG + Intronic
1170292306 20:14784218-14784240 AGCAAAAACAGCAAAGGAAAGGG - Intronic
1170307039 20:14950038-14950060 AGCATAGACAACCCTAGAGATGG - Intronic
1171028321 20:21653109-21653131 AGCCAAATCAGACATAGAAAAGG - Intergenic
1173362593 20:42357968-42357990 AGCAAAGAAAGACCAAGAAATGG + Intronic
1173440218 20:43068818-43068840 TGAAAAGATAGCCATGGAAAGGG + Intronic
1173897491 20:46562028-46562050 AATAAAGACAGCCAGAGAAATGG - Intronic
1175406042 20:58729561-58729583 AGCAGAGACAGCAAAAGAGAGGG + Intergenic
1176914914 21:14613575-14613597 AGCAAAAACATGCATAGATAAGG + Intronic
1177410893 21:20729253-20729275 AACAAAGACAGACATTGATATGG + Intergenic
1177566715 21:22832339-22832361 ATCAAAGACTGCCAGAAAAAAGG + Intergenic
1177616551 21:23529205-23529227 AGAAAGGACAGGCATAAAAATGG + Intergenic
1178366074 21:31989833-31989855 AGCAAAGACACCCACAGAAATGG - Intronic
1178704398 21:34861397-34861419 AGCAATGACAGCCACAGACGGGG + Intronic
1179231624 21:39509006-39509028 AGGAGAGACAGCCACAGAAGAGG + Exonic
1179273534 21:39869882-39869904 ACCAAAGAAAGCCAGAGCAATGG + Intronic
1179346582 21:40563985-40564007 AGCAAGGCCAGCCATGCAAAAGG + Intronic
1181766663 22:25097320-25097342 AACAAAGACCCCCATAAAAATGG + Intronic
1182214800 22:28706952-28706974 AGAAAAGACACATATAGAAAAGG + Intronic
1182248437 22:28979677-28979699 AGCAAAAACAGCAAGAGACATGG + Intronic
1183513295 22:38248465-38248487 AGCAGAGACAGCCAGTGCAAAGG - Intronic
1183698646 22:39437571-39437593 AGCCAACACAGCCATGGCAAAGG - Intergenic
1184984581 22:48120975-48120997 GGCAAAGAGAGCAAGAGAAAGGG - Intergenic
949830022 3:8204385-8204407 ACCAAATAAAGCCAAAGAAATGG - Intergenic
950759037 3:15204132-15204154 AGCTGAGACAGACATAGAGAGGG - Intergenic
951031923 3:17892191-17892213 GTCAGAGACTGCCATAGAAAAGG + Intronic
951234758 3:20221160-20221182 GGAAAAGACAGCCAGAGCAAAGG - Intergenic
951599397 3:24356556-24356578 AGCAAAGCCAGGAATAGAATGGG - Intronic
951669581 3:25165338-25165360 AGAGAAGACTGGCATAGAAATGG - Intergenic
952121565 3:30250663-30250685 AGCAAAAGCAGTCATAGAGAAGG + Intergenic
954914016 3:54134040-54134062 AGGAAAGACAGACAAAGAATAGG - Intronic
955378819 3:58420505-58420527 AGCAAAGAGAGAGAGAGAAAGGG - Intronic
955634205 3:61008165-61008187 AGAACAGACAGGCATACAAATGG + Intronic
955735764 3:62036738-62036760 AGCAAAAAAAGCCATAGCTAAGG + Intronic
955845630 3:63160148-63160170 AGCAAATACAGCCAGTGGAAAGG - Intergenic
955916192 3:63911476-63911498 AGAAAAGACAACCATAAAGAGGG + Intronic
957667141 3:83247513-83247535 TGCAAAGACACACATACAAAGGG - Intergenic
957738799 3:84235286-84235308 AGCAAAGGTAGAAATAGAAATGG - Intergenic
958704510 3:97637541-97637563 AGCAAAGTCTGCCAAAAAAAAGG - Intronic
959631819 3:108515330-108515352 AGCAAAAGCATCCATAGAGAGGG + Intronic
959841135 3:110976704-110976726 AGGAAAGAGAGCACTAGAAATGG + Intergenic
961690774 3:128667871-128667893 AGCCAAATCAGACATAGAAAAGG - Intronic
962352473 3:134665837-134665859 AGGAAAGATAGCCAGAGGAAGGG + Intronic
962863884 3:139430555-139430577 AGCAAATACAGCCTTAGGGAAGG - Intergenic
962951610 3:140224953-140224975 AGGAAGGGCAGCCATAGAAAAGG + Intronic
963077807 3:141364030-141364052 AGAAATGACAACCATAGACAGGG + Intronic
964236831 3:154541123-154541145 AGGAAAGACAGGCAAGGAAATGG + Intergenic
964631884 3:158819540-158819562 AGCAAAAACAGCAACTGAAAGGG - Intronic
965896667 3:173585405-173585427 AGCCACGACAGCCGCAGAAACGG - Intronic
967108989 3:186276565-186276587 TGAAAAGACAGACAGAGAAAGGG + Intronic
967264103 3:187674968-187674990 AGCAAAAACAGCCATGGACTGGG + Intergenic
968542076 4:1172828-1172850 AGGACAGACAGACAAAGAAAGGG - Intronic
969082996 4:4634341-4634363 CTCAAAGACAGAAATAGAAATGG + Intergenic
969184691 4:5466429-5466451 ATGAAAAACAGGCATAGAAAGGG + Intronic
972759273 4:42086595-42086617 AGGAAAGACAGACTTTGAAACGG - Exonic
972881945 4:43435589-43435611 AGAAGAAACAGCCATAAAAAAGG - Intergenic
972898128 4:43648584-43648606 AGCACAGACAGACAAAGAGAAGG - Intergenic
972969806 4:44559413-44559435 AGCAAAGACATCCATATTACTGG + Intergenic
973078311 4:45958831-45958853 AGCAGAGGCAGCCATCTAAAAGG - Intergenic
973177491 4:47225719-47225741 GGCAATGATAGCCATATAAATGG - Intronic
973932777 4:55809574-55809596 AGAAAAGACAGTCAAATAAAAGG + Intergenic
974638778 4:64601860-64601882 AGCACAGACTGACATAGAAAGGG - Intergenic
974662864 4:64917277-64917299 AGCCAAAACTGCGATAGAAAGGG - Intergenic
974807845 4:66904088-66904110 AGCCAAGAAATCCATAAAAAAGG - Intergenic
975450698 4:74522479-74522501 TGCTGAGGCAGCCATAGAAATGG + Intergenic
975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG + Intergenic
977233181 4:94476342-94476364 AAAAAAGACAGCGAGAGAAAAGG - Intronic
977912694 4:102556467-102556489 AGCAAAAGCAGCCAGTGAAATGG + Intronic
979135673 4:117110121-117110143 AACAAACAAAGACATAGAAATGG + Intergenic
980787750 4:137576519-137576541 AACAAAAACAACAATAGAAAGGG + Intergenic
981989826 4:150904325-150904347 TGTAAAGACAGTCATAAAAAAGG - Intronic
982182636 4:152764031-152764053 AGCAAATATGGCAATAGAAAGGG + Intronic
982719434 4:158844397-158844419 ACAAAAGCCAGCCATGGAAAAGG - Intronic
983448635 4:167883367-167883389 GGGAAAGAGAGCCAAAGAAAGGG - Intergenic
984097400 4:175449413-175449435 AGCCAAGTCAGACATAGAAAAGG + Intergenic
984548357 4:181132791-181132813 AACAAAGACTGTCAAAGAAAAGG - Intergenic
984776992 4:183490452-183490474 AGCAAATTCAGCCACAGAATGGG - Intergenic
984939721 4:184920345-184920367 AGAAATGACAGCCAAAGAAAGGG - Intergenic
986527582 5:8697134-8697156 AGCAAAGAATGCAAAAGAAATGG - Intergenic
987029167 5:13960045-13960067 TGCAAAGACAAGAATAGAAAAGG + Intergenic
987619095 5:20316710-20316732 AGTAAAGACAGTTATAGAAGGGG + Intronic
987964575 5:24855105-24855127 ATCAGAGACTGACATAGAAAAGG - Intergenic
988279152 5:29122908-29122930 AGCAAAGACAAACATGAAAAGGG - Intergenic
988387766 5:30588880-30588902 AACATAGATAACCATAGAAAAGG + Intergenic
988935854 5:36082316-36082338 AGCAGATGCATCCATAGAAAAGG + Intergenic
990062751 5:51672339-51672361 AGGAGAGAAAGCCATACAAATGG - Intergenic
991016997 5:61943075-61943097 AGCAAAGGCAGCCTTAAACAGGG + Intergenic
991283844 5:64947031-64947053 ATCAAAGAAAGCCAAATAAATGG - Intronic
991310121 5:65229250-65229272 AGTAGGGACATCCATAGAAAAGG + Intronic
991505136 5:67316955-67316977 GGGGAAGACAGCAATAGAAATGG - Intergenic
991611620 5:68455476-68455498 TCCAAAGACAGCCAAAGAGAAGG + Intergenic
992004738 5:72466278-72466300 AGCAAAAACAGCCATAGAGAAGG - Intronic
992425516 5:76652899-76652921 CTGAAAGACAGCTATAGAAAGGG + Intronic
992874632 5:81041578-81041600 AGCAAAGACAGACATGGAATGGG - Intronic
992937801 5:81727957-81727979 AAAGAAGCCAGCCATAGAAAGGG + Intronic
993644951 5:90450945-90450967 AGCAAAAATAGCCAGAAAAATGG - Intergenic
993916688 5:93752171-93752193 AGTAAAGACAGCCATAGGAAGGG + Intronic
994559105 5:101345155-101345177 AGCAAAGTCAGAAATAGAGATGG + Intergenic
994987549 5:106956558-106956580 AGCAAAGAATGCCTTAGTAAAGG - Intergenic
995980584 5:118098109-118098131 GGCAAAGACAGTGAGAGAAATGG - Intergenic
996005328 5:118414164-118414186 TGAAAAGACAACCATAGAATGGG + Intergenic
996007463 5:118440113-118440135 AGCAAAGACAGCCTCAAAACAGG + Intergenic
997463259 5:134070066-134070088 AAAAAAAACAGCCATACAAATGG + Intergenic
998544368 5:143014092-143014114 AACAAAGACAGCCAGAGTGAAGG + Exonic
999193634 5:149767151-149767173 AGCAAAGCCAGCAAGGGAAATGG - Intronic
999350198 5:150862808-150862830 AGCAATGACAGCCCTAGACCAGG + Intronic
999625887 5:153519700-153519722 AGGAAAGACAGTCCTAGACAAGG + Intronic
999735985 5:154513538-154513560 AGGAAAGACAACAATAGAGATGG - Intergenic
999737590 5:154524169-154524191 ACCATAGACAACCATAGAACTGG + Intergenic
999828521 5:155297221-155297243 AGCAAAGACAGAGATAAAGATGG - Intergenic
1001571963 5:172735953-172735975 GGCAAAGACAGACACAGAGAGGG + Intergenic
1002349675 5:178575298-178575320 TGGAAAGACAGCCTTAGGAAGGG - Intronic
1002874793 6:1201454-1201476 AGCAAAGACAGCCAGGGACCAGG + Intergenic
1002874823 6:1201606-1201628 AGCAGAGACAGCCATGGACCAGG + Intergenic
1002969834 6:2003853-2003875 GGCAAAGACAGCATTGGAAAAGG - Intronic
1003953283 6:11139483-11139505 ACTAAATACAGCCATAGAAAAGG + Intergenic
1004071556 6:12302726-12302748 TGCAAAGAGAGCCCTGGAAATGG - Intergenic
1004798775 6:19120814-19120836 ATCCAAGAGAGGCATAGAAATGG + Intergenic
1005641210 6:27798302-27798324 AGCAAAGACAGCCATGGGGTGGG - Intergenic
1005911151 6:30310693-30310715 AAAAAAGACAGCCAAAGGAAAGG + Intergenic
1007464847 6:42044441-42044463 AGCAAAGAATGACATAGAAGAGG + Intronic
1007718350 6:43870208-43870230 GGCAAAGGCAGCCATGGAAGAGG + Intergenic
1008099901 6:47379195-47379217 AGCAAAGAAAACCATAGTATTGG - Intergenic
1009412376 6:63380748-63380770 AGCAAAAACATGCATATAAAAGG - Intergenic
1010337129 6:74699558-74699580 AGTAAAGACTGCCATGGAATTGG + Intergenic
1010863525 6:80943266-80943288 CCCAAAGAAAGACATAGAAATGG - Intergenic
1011237362 6:85232126-85232148 AGCAAAGACAGGCACACAGAGGG + Intergenic
1013049566 6:106519365-106519387 AGCCAAAAAAGCCAAAGAAATGG + Exonic
1014579521 6:123119517-123119539 AGGAAAGACAGCAGTACAAAGGG - Intergenic
1014600637 6:123407504-123407526 AGCAAAAGCAAGCATAGAAAGGG - Intronic
1014853813 6:126374491-126374513 AGAAAAGACAGGCATAGACATGG + Intergenic
1015138162 6:129897721-129897743 AGCAAAGCGAGCTAGAGAAAAGG + Intergenic
1015227514 6:130874447-130874469 AACAAAGACAGAAATTGAAAAGG + Intronic
1016012127 6:139148221-139148243 AGCAAAGACAACCATAAATAAGG - Intronic
1016354011 6:143198088-143198110 TGCAAAGAGAGCCAAAGGAAAGG + Intronic
1016763397 6:147765502-147765524 GACAAAGAGAGCCAGAGAAAAGG + Intergenic
1016766997 6:147806120-147806142 AAGAAAGACAGCTACAGAAATGG + Intergenic
1017495145 6:154977214-154977236 TGCCAAGACAGCCAGAGAGAAGG - Intronic
1017558014 6:155593837-155593859 AGCAAAGACAGAGATTTAAAGGG + Intergenic
1017849133 6:158288154-158288176 ATTTAAGACAGCCATATAAAAGG - Intronic
1018758312 6:166868599-166868621 AGCAAAGATGGCCATTGTAATGG + Intronic
1018832119 6:167451193-167451215 AGCAGAGAGAGCCATAGAGTGGG + Intergenic
1020341874 7:7120060-7120082 AGTAGAGACAGCCATAGCCAAGG - Intergenic
1021478006 7:21084838-21084860 ACCAAAGACAGCAATAAAACTGG + Intergenic
1021554834 7:21908833-21908855 AGGAGAGACAGTCACAGAAAAGG + Intronic
1021667469 7:22999637-22999659 AGCAAAAACAAACATAGAATGGG + Intronic
1021676570 7:23086044-23086066 AGCCAAATCAGACATAGAAAAGG + Intergenic
1023859900 7:44212351-44212373 AGAAGAGACAGCCATAGACGAGG + Exonic
1024159662 7:46661615-46661637 AGCAAAGACAGGCAAAGCACTGG + Intergenic
1024442765 7:49440355-49440377 AAAAAAGTAAGCCATAGAAAAGG + Intergenic
1027129875 7:75583166-75583188 AGCAAAGGCAGGCAGAGAGATGG - Intronic
1027750129 7:82133141-82133163 AGCAATGACAGCCTTAAACATGG + Intronic
1028000772 7:85495108-85495130 AGTAAAGATAGCCATACAATTGG + Intergenic
1029587623 7:101485596-101485618 AACAAAGGCAGCCATAGGCAGGG - Intronic
1030854816 7:114542149-114542171 AGAAAAGAAAGCAGTAGAAAAGG - Intronic
1032082328 7:128865927-128865949 GCCAAAGACAGGCATAGAAGAGG + Intronic
1032788206 7:135218628-135218650 GGCAAAGCCAGCCAAAGGAAGGG - Intergenic
1033383180 7:140844444-140844466 AGGAAAGACAGCAGCAGAAATGG - Intronic
1034876578 7:154729921-154729943 TGCAGAAACAGCCCTAGAAATGG + Intronic
1035619006 8:1023780-1023802 AACACAGACAGACATTGAAACGG - Intergenic
1035948566 8:3993045-3993067 AGAAAAGACATCAGTAGAAAAGG + Intronic
1036417907 8:8567332-8567354 AGAAAAGACAGGAAGAGAAAGGG - Intergenic
1037155418 8:15693559-15693581 AGCTAAGGCAGCTAGAGAAAAGG - Intronic
1037224984 8:16575643-16575665 TGGAAAGACAGTCATTGAAATGG - Intergenic
1038377420 8:27055467-27055489 AGTAATGAAAGCCATAAAAATGG - Intergenic
1039159704 8:34603624-34603646 AGCAGAGAGAGCCTTAGAGAGGG + Intergenic
1039596150 8:38791530-38791552 TGCAAAGACAGCCAGAGCACAGG + Intronic
1039607107 8:38890248-38890270 AGCAAAAAAAGCCAAACAAAAGG - Intergenic
1040358626 8:46643632-46643654 AGCAAAAACAGCTACAGAATGGG - Intergenic
1040585484 8:48736474-48736496 AGCTAAGGCAGCAATAAAAAGGG + Intergenic
1043239920 8:77919443-77919465 AGCCCATACAGCCACAGAAAGGG - Intergenic
1043458294 8:80433770-80433792 AGAAATCACAGCCATAAAAAAGG - Intergenic
1044340499 8:91041041-91041063 AGCCCAGCCAGCCAGAGAAAAGG + Exonic
1045482264 8:102601649-102601671 AGCAAAGATAGTGACAGAAATGG - Intergenic
1046224609 8:111261482-111261504 AGAAGAGACTGCCATAGAGATGG - Intergenic
1046678570 8:117140734-117140756 AGTAAAGAAAGCAATAGTAAAGG + Intronic
1046721339 8:117622650-117622672 AGCCAAGGCAACAATAGAAAAGG + Intergenic
1047354110 8:124104015-124104037 AGCAGAGACAGAAAGAGAAATGG - Intronic
1048324379 8:133427918-133427940 ATCAAAAACAACCATAAAAATGG + Intergenic
1048768931 8:137874313-137874335 CTCAAAGACAGCCATGCAAAGGG - Intergenic
1050488443 9:6161292-6161314 AACAAAGACAGAAATAGAATGGG - Intergenic
1055178995 9:73359556-73359578 AGCATACACAGGAATAGAAATGG + Intergenic
1055978199 9:81974826-81974848 AGCAAAGACATGGATAGAAATGG - Intergenic
1056341428 9:85636646-85636668 AGCACAGAGAGGCAAAGAAAAGG + Intronic
1056854151 9:90110712-90110734 AGTAAAGACAGCCAGATCAAGGG - Intergenic
1058706019 9:107638397-107638419 AGGAAAGACAGGAAAAGAAAAGG - Intergenic
1059848123 9:118304167-118304189 GGAAAAGAGAGTCATAGAAAGGG - Intergenic
1060417158 9:123439080-123439102 AGCAAACACAGCCAGGGAACTGG + Intronic
1061379938 9:130248975-130248997 AGCAAAGAAACCTAAAGAAATGG - Intergenic
1187457896 X:19458911-19458933 AGCCAAGACATCCTTAGAGATGG + Intronic
1187732077 X:22265369-22265391 GACAAAGACAGGCATAGAAAGGG - Intergenic
1188438957 X:30195443-30195465 AGCAAAGAGAGTTAGAGAAAGGG - Intergenic
1188838685 X:34989034-34989056 AGCCAAATCAGACATAGAAAAGG + Intergenic
1189500854 X:41556753-41556775 AGCAAAGTCATACATACAAATGG + Intronic
1189669902 X:43396469-43396491 AGTCAAGACCACCATAGAAAAGG + Intergenic
1189933233 X:46037207-46037229 AGCACAGAAGGCTATAGAAAAGG - Intergenic
1190628257 X:52358644-52358666 AGAAATGACAGCCATAAAAGTGG - Intergenic
1190679582 X:52813329-52813351 AGGAAAGAAAGCAATAGGAAAGG + Intronic
1193250707 X:79288336-79288358 GGCAGAGAAAGCCAGAGAAATGG + Intergenic
1194443910 X:93964476-93964498 CTTAAAGACAGCTATAGAAAAGG - Intergenic
1196484865 X:116194781-116194803 TGCAAAGAAAGACATACAAATGG + Intergenic
1196595006 X:117534998-117535020 AGCAAAGAATTCCAGAGAAAGGG - Intergenic
1196850618 X:119934516-119934538 AGCAAAGAAAGCCAAGAAAAAGG - Exonic
1196885243 X:120238201-120238223 AGCAAAGACAGCTAAGAAAAAGG - Intergenic
1197841600 X:130753582-130753604 AGCAGAGACAGACAGACAAATGG - Intronic
1198097305 X:133392576-133392598 GGTAAAGAAAGACATAGAAATGG + Intronic
1198398058 X:136242960-136242982 AGCATAAACAACCACAGAAAAGG + Intronic
1198442732 X:136679753-136679775 AGCAAAGACAGCCATAGAAAGGG + Intronic
1199362315 X:146936315-146936337 AGCAAAGGAAGCAATAAAAAAGG - Intergenic
1199737130 X:150694703-150694725 AGCTAAGACAGCACTTGAAATGG + Intronic