ID: 1198442982

View in Genome Browser
Species Human (GRCh38)
Location X:136682708-136682730
Sequence GCAGACCCCCTAACGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198442982 Original CRISPR GCAGACCCCCTAACGAAAAC AGG (reversed) Intronic
1075893446 10:125974290-125974312 GCAGACCCACTGACGAAGACAGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078706580 11:13749437-13749459 ACAGACCCCCTAAAGGAAGCGGG + Intergenic
1083188910 11:61035564-61035586 GAAGACACCCACACGAAAACCGG + Intergenic
1090232762 11:125120715-125120737 CCAAACCCCCTAAAGAAAAAAGG + Intergenic
1093539943 12:20269569-20269591 GCAGAACTGCTAACAAAAACAGG - Intergenic
1096094795 12:48927171-48927193 GCAGAGCCACTAACAGAAACAGG - Intronic
1103411161 12:120711998-120712020 TCAGAGCCCCAAATGAAAACTGG - Intronic
1103865267 12:124046468-124046490 GCAGACACCCAAACAAAATCTGG - Intronic
1115036603 14:28864949-28864971 CAAGACCCCCAAACCAAAACAGG + Intergenic
1115394867 14:32897072-32897094 ACAGAACACCTAACCAAAACTGG - Intergenic
1118535551 14:66759331-66759353 GCAGAGCCCCTTGGGAAAACTGG - Intronic
1121368898 14:93338981-93339003 GCAGACCCCTTAACCAGAAGAGG + Intronic
1134902716 16:17953156-17953178 GCAGACCCCAGAAGGAAGACTGG + Intergenic
1139908272 16:70381168-70381190 GCAGACCCACCAAAGAAAAGCGG - Exonic
1159127799 18:64245431-64245453 GTAGACCCCCAAAGGAAAATTGG + Intergenic
1160455074 18:78993926-78993948 GCAGCCCCCCGAACGGAAACTGG - Exonic
1162241747 19:9360795-9360817 GCAGACCCCAAATTGAAAACAGG - Intronic
1164794551 19:31015427-31015449 GCAGGCCCACTTATGAAAACTGG - Intergenic
937865377 2:126747529-126747551 GCAAAACCCCTATGGAAAACAGG - Intergenic
940860489 2:158765662-158765684 GCAGACCCCCAAAGGAAGGCTGG - Intergenic
944672933 2:202010816-202010838 GCAGAAACCCTAACTCAAACTGG - Intergenic
1171352156 20:24511511-24511533 TCAGACCCCCAAACAAAGACGGG - Intronic
950897661 3:16468111-16468133 GCAGACCCCAGAATGATAACAGG + Intronic
956839508 3:73124646-73124668 TGGGACCCCCTAAGGAAAACTGG - Intergenic
961556557 3:127700208-127700230 GCAGGAACCCTAACAAAAACTGG + Intronic
970319204 4:14859198-14859220 ACAGACCCCCTAAGGTAAACTGG + Intergenic
976538423 4:86244591-86244613 GAAGCCACCCTAATGAAAACAGG + Intronic
992548418 5:77838324-77838346 AGAGAGCCCCTACCGAAAACAGG - Intronic
993478923 5:88398484-88398506 ACAGACACACTAACCAAAACGGG - Intergenic
997442545 5:133918967-133918989 GCAGACGCCCTCACCAAATCAGG + Intergenic
1009788756 6:68372327-68372349 GCAGAACCCCTTACCAAAAGTGG - Intergenic
1024381699 7:48704150-48704172 GCAGATTCCCTAACCACAACTGG - Intergenic
1040585449 8:48736267-48736289 GCATTCCCCCCAATGAAAACGGG + Intergenic
1045415036 8:101957793-101957815 GCAGATCTCCTAAGAAAAACTGG + Intronic
1061749158 9:132763739-132763761 GCAGCCCCCCAAACCAGAACAGG - Intronic
1062396735 9:136355627-136355649 GCAGACCCCCAGACGAGACCGGG - Intronic
1194899997 X:99498109-99498131 GCAGTTGCCCTAAGGAAAACAGG + Intergenic
1198442982 X:136682708-136682730 GCAGACCCCCTAACGAAAACAGG - Intronic