ID: 1198444826

View in Genome Browser
Species Human (GRCh38)
Location X:136702001-136702023
Sequence AAGAATAAGAAAAATGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7451
Summary {0: 1, 1: 2, 2: 38, 3: 506, 4: 6904}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198444826_1198444828 28 Left 1198444826 X:136702001-136702023 CCGGCCTCATTTTTCTTATTCTT 0: 1
1: 2
2: 38
3: 506
4: 6904
Right 1198444828 X:136702052-136702074 TAATAATAGCAACAGTGTATTGG 0: 1
1: 6
2: 22
3: 69
4: 289
1198444826_1198444829 29 Left 1198444826 X:136702001-136702023 CCGGCCTCATTTTTCTTATTCTT 0: 1
1: 2
2: 38
3: 506
4: 6904
Right 1198444829 X:136702053-136702075 AATAATAGCAACAGTGTATTGGG 0: 3
1: 10
2: 30
3: 98
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198444826 Original CRISPR AAGAATAAGAAAAATGAGGC CGG (reversed) Intronic
Too many off-targets to display for this crispr