ID: 1198450568

View in Genome Browser
Species Human (GRCh38)
Location X:136763522-136763544
Sequence TAGGGTTATAAAGATGATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198450561_1198450568 16 Left 1198450561 X:136763483-136763505 CCTAAGCACTTGCTCTGTGCCAT 0: 1
1: 0
2: 3
3: 42
4: 363
Right 1198450568 X:136763522-136763544 TAGGGTTATAAAGATGATCACGG 0: 1
1: 0
2: 2
3: 21
4: 204
1198450560_1198450568 20 Left 1198450560 X:136763479-136763501 CCTTCCTAAGCACTTGCTCTGTG 0: 1
1: 0
2: 3
3: 36
4: 289
Right 1198450568 X:136763522-136763544 TAGGGTTATAAAGATGATCACGG 0: 1
1: 0
2: 2
3: 21
4: 204
1198450559_1198450568 21 Left 1198450559 X:136763478-136763500 CCCTTCCTAAGCACTTGCTCTGT 0: 1
1: 0
2: 1
3: 36
4: 319
Right 1198450568 X:136763522-136763544 TAGGGTTATAAAGATGATCACGG 0: 1
1: 0
2: 2
3: 21
4: 204
1198450567_1198450568 -9 Left 1198450567 X:136763508-136763530 CCTGTACTGGGCGCTAGGGTTAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1198450568 X:136763522-136763544 TAGGGTTATAAAGATGATCACGG 0: 1
1: 0
2: 2
3: 21
4: 204
1198450564_1198450568 -3 Left 1198450564 X:136763502-136763524 CCATGTCCTGTACTGGGCGCTAG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1198450568 X:136763522-136763544 TAGGGTTATAAAGATGATCACGG 0: 1
1: 0
2: 2
3: 21
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198450568 Original CRISPR TAGGGTTATAAAGATGATCA CGG Intronic
906795234 1:48691643-48691665 TAGAGTTATGCAAATGATCATGG - Intronic
907126755 1:52056867-52056889 GGGGGTTATAAAGATGGGCAAGG - Intronic
907701894 1:56796918-56796940 TAGGGTTACAAAGATGAATGAGG + Intronic
908095360 1:60731891-60731913 TAGGGTTTTAAAGACAATCAAGG + Intergenic
908946944 1:69510041-69510063 TAGGGATATGAAGATAAACAAGG + Intergenic
909014675 1:70369336-70369358 TAGGGTTGTAAAGCTTCTCAGGG - Intronic
910316891 1:85896046-85896068 TAGGGTGAAAAAGGAGATCAAGG - Exonic
910747948 1:90593995-90594017 TAGCACTATAAAGATCATCAGGG + Intergenic
911678794 1:100691006-100691028 GGGGGTTATTAAGCTGATCAGGG - Intergenic
912478431 1:109958611-109958633 TAGGGGTATAAAAATGATTAAGG - Intergenic
913118387 1:115717449-115717471 AAGGGTTTTTAAGAGGATCATGG - Intronic
916157112 1:161863486-161863508 GAGTATTATAAAGATGAACATGG + Intronic
917589476 1:176461650-176461672 TTGAGTTATAAAGATGACTAGGG + Intergenic
920544174 1:206801782-206801804 CAGGGATATAGAGATGATTAAGG - Intronic
920833835 1:209489156-209489178 TAGGATTTCAAAGATGAGCAAGG - Intergenic
924162750 1:241250941-241250963 TAGGGATTTAAAGATGAGCAAGG - Intronic
924667397 1:246087354-246087376 CAGGGTTCTAGAGATGATTAAGG - Intronic
1066191768 10:33062424-33062446 TAGGGGTATAAAGCTGAATAGGG + Intergenic
1070367812 10:75753142-75753164 TAGGGCTTTAAAAATGAACAGGG - Intronic
1071361599 10:84851741-84851763 TAGGGTTTTTAAGGGGATCATGG - Intergenic
1073933175 10:108599771-108599793 TAGGGTTGTAAAGTTTCTCAGGG - Intergenic
1074196679 10:111194262-111194284 TAGGGTAAAATAGATGATAACGG - Intergenic
1074474718 10:113760050-113760072 TAGGGATAGAAAGCAGATCAGGG - Intronic
1074812578 10:117120693-117120715 TAGTGTTAGATAGATGAGCAGGG + Intronic
1076061310 10:127416394-127416416 GAGGGTGATTAAGAGGATCACGG - Intronic
1079966439 11:26985839-26985861 TAGGATTAAAAAGCTAATCAAGG + Intergenic
1088013879 11:105036192-105036214 TAAGGTTAGAAAAATAATCAAGG + Intergenic
1088115184 11:106304802-106304824 TAGGGCTATCAAAAAGATCATGG + Intergenic
1089709504 11:120305051-120305073 TGGGGTTCTAAAGAGGATCCTGG - Exonic
1090119005 11:124005022-124005044 TAAGGTTATAAAGAAAATCAAGG - Intergenic
1090464694 11:126923783-126923805 TATGGTTATAAAAAGGATCTGGG - Intronic
1092977432 12:13758867-13758889 TAGGGATCTAGAGATGAACAAGG - Intronic
1093077425 12:14772260-14772282 TTGGGTTATGAAGATGGGCATGG - Intergenic
1093227968 12:16508133-16508155 TAGGAGTATAATGATAATCAAGG - Intronic
1094043235 12:26139909-26139931 TAGGGCTATAAAAATGAATAAGG + Intronic
1094116041 12:26914211-26914233 AAGGATTTTAAAGATTATCATGG + Intronic
1094417292 12:30230867-30230889 TAGGGTTTTTAAGAGGATCATGG + Intergenic
1095128148 12:38506675-38506697 AAGTGTTATAAAAATCATCATGG - Intergenic
1097485076 12:60186683-60186705 GATGTTTATAAGGATGATCATGG + Intergenic
1099254097 12:80294530-80294552 AAGGGTCATTAAGATGATTATGG - Intronic
1099847698 12:88049842-88049864 TAAAGTTATTAATATGATCAGGG + Exonic
1099891519 12:88594081-88594103 TAGAGACATAAACATGATCAGGG + Intergenic
1100729012 12:97443104-97443126 TAAGCTTATAAAAATGAGCAAGG + Intergenic
1101927208 12:108982207-108982229 TATGGTGATGAAGATGATGATGG - Intronic
1102744177 12:115235220-115235242 CAGGGATATAAAGACCATCAGGG - Intergenic
1103083190 12:118041627-118041649 AAGGGTCATGAAGAGGATCAGGG - Intronic
1103282064 12:119766788-119766810 AAGGATTATAGAAATGATCATGG + Intronic
1106192381 13:27464871-27464893 TACTGTTAGAAAGGTGATCATGG + Intergenic
1106574399 13:30961297-30961319 CAGGGTTATGAAGGTGATCCGGG + Intronic
1109154677 13:58892318-58892340 TAGGTGTATAAACCTGATCAAGG + Intergenic
1109708718 13:66135441-66135463 TAGTATTCTAAAGAGGATCACGG + Intergenic
1110191373 13:72733007-72733029 AAGGTTTATAAAGATAATCTTGG + Intronic
1114880538 14:26780035-26780057 TAGGGATACAGAGATGAGCAAGG + Intergenic
1115005310 14:28475573-28475595 TAGGGATATAGATATAATCAAGG + Intergenic
1115368440 14:32584670-32584692 TAGTGTCATAAAGCAGATCAAGG - Intronic
1116431490 14:44850593-44850615 TAGTGTTAGACAGATTATCAAGG - Intergenic
1116471506 14:45290963-45290985 TGGGGTTAAAAAGATGACTAAGG + Intergenic
1116808772 14:49519490-49519512 TAGGGATATACTGATGAGCAAGG - Intergenic
1119527949 14:75337364-75337386 TTGGGTTATAAGAATCATCATGG + Intergenic
1121721709 14:96113566-96113588 AAGGGCTACAAAGATGTTCAGGG + Intergenic
1124198012 15:27650217-27650239 TAGGGTTTTTAAGGGGATCATGG + Intergenic
1125382088 15:39096993-39097015 TAGGGTAATAGTGATGATTAAGG + Intergenic
1127186757 15:56488430-56488452 TAGGGATATCAAGGAGATCAAGG + Intergenic
1127589121 15:60405771-60405793 TGGGGTTACAAAGATGAACAAGG - Intergenic
1129380806 15:75164899-75164921 TTGGGTTATAAAGACAATAAGGG + Intergenic
1130007684 15:80116561-80116583 TAGTGTTATAAAGAAAATCTGGG + Intronic
1130199762 15:81814061-81814083 TGGGGAAATAAAGATGATCTAGG + Intergenic
1131100753 15:89688311-89688333 AAAGGTTATACAGATCATCAAGG + Intronic
1133629721 16:7608543-7608565 TAGGGTTTGCAATATGATCATGG - Intronic
1133849863 16:9492633-9492655 TAGGGTTTTTAAGGGGATCATGG + Intergenic
1135316097 16:21445633-21445655 TTGGGATATAATGGTGATCAAGG - Intronic
1135369022 16:21877895-21877917 TTGGGATATAATGGTGATCAAGG - Intronic
1135442794 16:22493248-22493270 TTGGGATATAATGGTGATCAAGG + Intronic
1135649032 16:24189305-24189327 TTGGGTTATTATGATGATCAGGG + Intronic
1135869944 16:26140400-26140422 GATGGTGATAAAGATGACCATGG + Intergenic
1136312775 16:29424369-29424391 TTGGGATATAATGGTGATCAAGG - Intergenic
1136326209 16:29526120-29526142 TTGGGATATAATGGTGATCAAGG - Intergenic
1136440898 16:30266104-30266126 TTGGGATATAATGGTGATCAAGG - Intergenic
1138218606 16:55227808-55227830 AAGTGTTATAAAGAAGAACAAGG + Intergenic
1138821526 16:60265966-60265988 TAGGATAATAATGATGAACATGG - Intergenic
1139887412 16:70218420-70218442 TTGGGATATAATGGTGATCAAGG - Intergenic
1142736948 17:1907200-1907222 TAGGCTTATAAATATGTTCCAGG - Intergenic
1142896646 17:2983890-2983912 GAGGGTCATATAGATGATGATGG + Intronic
1143246281 17:5488141-5488163 CAGGGTTATAAAGCTGACAAGGG + Intronic
1146124857 17:30223498-30223520 TATGGCTATAAACATGAGCAAGG + Intronic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1156216970 18:35009333-35009355 TAGGGATATAGAGGTGACCAAGG + Intronic
1159442232 18:68496289-68496311 TAGCATTATAAAGAAGACCAGGG + Intergenic
1164892024 19:31832125-31832147 TATGTTTATAAAGATGAGGAGGG + Intergenic
1166349700 19:42190396-42190418 TAGGGTTGTAGGGATGCTCAAGG + Intronic
1168322774 19:55519945-55519967 TATGGTGGTAAAGATGATCTTGG + Intergenic
926044568 2:9700466-9700488 TTGAGTTATAAAGATGGGCAAGG - Intergenic
926150078 2:10420674-10420696 TTGGGTTATGAAGATGAAAACGG - Intronic
926412195 2:12616007-12616029 TAGGGTTATAAAGTTAATATAGG + Intergenic
926859753 2:17296583-17296605 TAGGGTTATAAAAATGTATAAGG - Intergenic
930457670 2:51626669-51626691 TAGGATGGTAAAGATCATCATGG + Intergenic
931123539 2:59248087-59248109 TAAGGATCTAAAGATGATTAGGG - Intergenic
931764560 2:65443432-65443454 TAGGGCAATAATGATGATCATGG + Intergenic
934163346 2:89272706-89272728 TAGGGTTAAAGAGGTGATCAGGG - Intergenic
934203928 2:89909818-89909840 TAGGGTTAAAGAGGTGATCAGGG + Intergenic
936557280 2:113507869-113507891 AAGGGATACAATGATGATCAAGG + Intergenic
936869444 2:117117291-117117313 TAGGGTTATAAGGATAAATAAGG - Intergenic
940267849 2:151858883-151858905 TAGGGGTATAAAGAAGAGTAGGG - Intronic
941645841 2:168040154-168040176 TAGTAATATAAAGATGAACAAGG - Intronic
945581380 2:211599619-211599641 TAGAGGTATAAAGATTACCAAGG - Intronic
945628631 2:212242420-212242442 TAGAGTCATAAAGATAATAATGG + Intronic
946338013 2:219051133-219051155 TAGGGTCATAAAGAAGGTGATGG - Intergenic
1168744714 20:228534-228556 TTGGGTTATTAAGATGAACAAGG + Intronic
1169831901 20:9834706-9834728 GAGGGTTATAGTGATGATTATGG + Intronic
1172470443 20:35189805-35189827 TAAGGATACAAAGATGAACAAGG - Intergenic
1172870346 20:38131766-38131788 AAGGGCTATAATGATGATGATGG + Intronic
1173323155 20:42007875-42007897 GAAGGTTGTATAGATGATCAGGG + Intergenic
1175674460 20:60934784-60934806 CAGGGTTATTGTGATGATCAAGG - Intergenic
1177470671 21:21557421-21557443 TAGTGTTAGACAGATCATCAAGG - Intergenic
1178665209 21:34540652-34540674 TAGAGATATAAAGATGAGGAAGG + Intronic
1183079364 22:35446788-35446810 TTGGGTGATGAAGATGCTCAGGG - Intergenic
1185141652 22:49105910-49105932 CCGGGTTAAAAAGATGACCAAGG - Intergenic
1185199405 22:49492311-49492333 AAGGGTTATGAAGTTGACCATGG - Intronic
951707882 3:25562015-25562037 TAGGGTAAAAAAGTTGAGCAGGG - Intronic
952721168 3:36534428-36534450 TAGGGTTATAAATATCATATTGG - Intronic
953419609 3:42744263-42744285 TAGCGTTATAAGGGTGATAAGGG - Intronic
956283936 3:67589054-67589076 AAGGGACAGAAAGATGATCATGG - Intronic
958499117 3:94883161-94883183 TAGGGTTTTAAAGAGGAACTGGG - Intergenic
959451660 3:106510985-106511007 GAGAGTTATAAACATGATAAAGG + Intergenic
960431839 3:117578971-117578993 CAGGGATATAAAAATGAACAAGG + Intergenic
963161321 3:142153290-142153312 TAAGATTATAAAGAAGAACATGG - Intergenic
964127982 3:153256545-153256567 TAGGGCTCAAAAGATGACCAAGG - Intergenic
965827876 3:172749145-172749167 TGGGGTTATAAAGATGAATAAGG - Intergenic
966016852 3:175150661-175150683 AAGGGATATAAAGATTATCAGGG + Intronic
967535537 3:190597901-190597923 CAGGGCTATAAAGATTTTCAGGG + Intronic
967765812 3:193278172-193278194 TAGAGTTACAAAGATGAATAAGG - Intronic
968075322 3:195812941-195812963 TAGGGTTGTAAAGACGAAGAGGG + Intergenic
969560029 4:7940948-7940970 AGAGGTTTTAAAGATGATCAGGG - Intergenic
970161907 4:13197518-13197540 CAGGATTATAAAAATGATGAAGG - Intergenic
970498961 4:16657330-16657352 CAGGGTAATAATGATGATGATGG - Intronic
971622721 4:28876284-28876306 GTGGGTCATAAAAATGATCATGG - Intergenic
973342756 4:49022826-49022848 TATGTATATAAAGATGTTCATGG + Intronic
974896601 4:67947798-67947820 TAGCGGTAAAAAGATGAACAAGG - Intronic
975095458 4:70451380-70451402 TAGTGATATAAAGATAAACAAGG + Intronic
976004555 4:80413962-80413984 CATGCTTATAAAGATGAACATGG - Intronic
977387255 4:96357470-96357492 TAGGGTTACAAAAAGGATTATGG - Intergenic
978147471 4:105392766-105392788 TAGGAATATAAAGATGAATAAGG + Intronic
978825401 4:113016558-113016580 TAGGGCTAAAAAGCTGATGAAGG + Intronic
979833351 4:125329065-125329087 TAGGTTAATAAAGATTATAAAGG - Intronic
980591357 4:134893692-134893714 TAGGGTTTTAATCATGTTCATGG - Intergenic
982523551 4:156450209-156450231 TAGGGAAATAAAGATGATTATGG - Intergenic
982554961 4:156849196-156849218 TAGTCTTCTAAAGATAATCAGGG + Intronic
984523685 4:180830919-180830941 TAGTGTGATAAAAATGAACATGG - Intergenic
986722398 5:10568989-10569011 TAGATTTATAGCGATGATCAGGG + Intronic
989018810 5:36974659-36974681 TAGTGTGATAAAGATGATATGGG - Intronic
990681568 5:58250497-58250519 TGGGATTATAAAGATAATGAAGG + Intergenic
990819891 5:59826202-59826224 TAGGGATATAGAGGTGAACAAGG - Intronic
991349787 5:65709155-65709177 TAGGAATAGAAATATGATCAAGG + Intronic
991351643 5:65725274-65725296 TAGCTTTTTAAAGATAATCATGG + Intronic
992905943 5:81345733-81345755 AAGGGTTAAAAATATGTTCATGG + Intronic
994512877 5:100729480-100729502 AAGGGGTATAAATATGAGCAAGG + Intergenic
995053550 5:107733712-107733734 TAGGGTTATACAGAGTTTCAGGG - Intergenic
995152723 5:108868410-108868432 TAGGGATATAGAGATGAGCAGGG + Intronic
996891090 5:128421275-128421297 TATGTCGATAAAGATGATCAGGG + Intronic
998598038 5:143554792-143554814 TTGGGATATAAAGATAAACAAGG - Intergenic
998666226 5:144300939-144300961 TAGAGTCATAAAGATTATTACGG + Intronic
999036235 5:148353744-148353766 AAGAGTTTTAAGGATGATCAAGG - Intergenic
1004412518 6:15394310-15394332 GAGGGTTATTGAGATGAGCAAGG + Intronic
1005714350 6:28532750-28532772 TAAGGATATAAAGATGAATAAGG + Intronic
1008455786 6:51709192-51709214 TAGTGTGATAAAGGTGAACATGG - Intronic
1010051672 6:71511843-71511865 TAGTGTTATGAAGAAGATAAAGG + Intergenic
1010296631 6:74206301-74206323 AATGGTCATGAAGATGATCACGG - Intergenic
1010887781 6:81264711-81264733 TAGGGATAGAAAGAAGATTATGG - Intergenic
1013094074 6:106928326-106928348 TACGGTTATAAAAAGGACCATGG + Intergenic
1013837214 6:114346545-114346567 TAGGGCTATCAAGTTGAACAAGG + Intergenic
1014132565 6:117851422-117851444 AAAGGTTATAAAGATTATAAAGG - Intergenic
1018458046 6:163970352-163970374 TAGGGTTATGAAGATGAACAAGG - Intergenic
1019958398 7:4435621-4435643 TGGGGTTTTTAAGAGGATCATGG + Intergenic
1020363207 7:7352252-7352274 TAGGGATACAAAGATAAACAAGG + Intergenic
1020504344 7:8964627-8964649 TAGGGTAAGACTGATGATCAGGG - Intergenic
1021899229 7:25266684-25266706 TAGGGTTTTAATGTTGATCAAGG - Intergenic
1021927082 7:25543977-25543999 TAGGGCTATAAATATGTTGAGGG + Intergenic
1021936931 7:25640298-25640320 TAGGATTACAAATATTATCAGGG - Intergenic
1022607414 7:31829294-31829316 TAGGGTTATAAGGATGAAAGAGG + Intronic
1022848547 7:34235990-34236012 CAGGTGGATAAAGATGATCATGG - Intergenic
1027209968 7:76138228-76138250 AAGGGTCATCAGGATGATCATGG - Intergenic
1028620377 7:92820299-92820321 TAGGGTTATAATGTTGAACCTGG + Intronic
1029900545 7:104034767-104034789 TAGGGTTTTTAAGGGGATCATGG - Intergenic
1030471726 7:109972536-109972558 TAGGGTTGTAAATATGCTAAAGG - Intergenic
1030886187 7:114940869-114940891 GAGGTTTGTAAAGATTATCAAGG - Intronic
1033056838 7:138062969-138062991 TAGGGATATGAATATGATCAAGG - Intronic
1035472477 7:159119258-159119280 TAGGGTTAGCAACATGCTCAGGG - Intronic
1035777065 8:2196320-2196342 TGGGGGTAGAAAGAGGATCATGG - Intergenic
1037264243 8:17040208-17040230 TAAGGTTAAAAATATGATAATGG - Intronic
1038662313 8:29507718-29507740 TAGGGTGACAAAGATGGTCCTGG - Intergenic
1040453252 8:47570061-47570083 TAGAATTAACAAGATGATCATGG + Intronic
1041312640 8:56532383-56532405 TATGGTTAAATAAATGATCATGG - Intergenic
1041936761 8:63340608-63340630 TAGGGTTTTTAAGGGGATCATGG + Intergenic
1044128355 8:88487554-88487576 TAAAGTTATTAATATGATCAGGG + Intergenic
1044630430 8:94273029-94273051 TAGGGTAATAATTATGATGATGG - Intergenic
1046452636 8:114414316-114414338 AATGGTGATAAAGATGAACATGG + Intergenic
1046510629 8:115197939-115197961 TATCTTTAAAAAGATGATCATGG + Intergenic
1046969138 8:120201784-120201806 TTGGGGTACAAAGATGAACAAGG + Intronic
1047959850 8:130003325-130003347 AAAGGTTATGAAGATGTTCAAGG + Intronic
1048158529 8:131988874-131988896 TAGGGCTATAAGGAAGATAAAGG - Intronic
1049199364 8:141332449-141332471 GTGGGCTCTAAAGATGATCAGGG - Intergenic
1051305620 9:15705917-15705939 TGAAGTTATAAAGGTGATCATGG + Intronic
1051931270 9:22389286-22389308 TAGAAGGATAAAGATGATCAAGG - Intergenic
1052101715 9:24454963-24454985 TAGAGTTAAAAAGATAATGAAGG - Intergenic
1052996346 9:34553434-34553456 TAGGGTTACAATGAGGACCAAGG + Intronic
1053738896 9:41119608-41119630 AAGGGATACAATGATGATCAAGG - Intergenic
1054689451 9:68311708-68311730 AAGGGATACAATGATGATCAAGG + Intergenic
1058496071 9:105560182-105560204 TAGGGATATAACGACGAGCAAGG + Intronic
1058548163 9:106083378-106083400 TAAGGTCATAAAGCTGATAAAGG - Intergenic
1059877907 9:118656627-118656649 TAGGGTTCTATAGATAAGCAAGG + Intergenic
1060257951 9:122048910-122048932 TAGGGATACACTGATGATCATGG - Intronic
1061984606 9:134122995-134123017 AAGTGTAATAGAGATGATCAGGG + Intergenic
1185906634 X:3939623-3939645 GAGGGTGATAAAAATGTTCAGGG - Intergenic
1187673075 X:21687850-21687872 TAGGGCTATAAAGATAATCATGG + Intergenic
1187920701 X:24198766-24198788 TTGGGTTATAAGTATGGTCAGGG + Intronic
1188018497 X:25130679-25130701 TAGAGTTATAAGGATGAGTATGG + Intergenic
1188482233 X:30647887-30647909 TAGGGATATAATGATTATCAGGG + Intergenic
1190462967 X:50697089-50697111 TAGAGATATAAAAATGAACAAGG + Intronic
1193770160 X:85578690-85578712 TAGTGTTAAACAGATCATCAAGG + Intergenic
1193817697 X:86123955-86123977 CAGTGTTAGAAAGATCATCAAGG - Intergenic
1194850921 X:98867893-98867915 TGGGGTTATAAAGGTGATAATGG - Intergenic
1197218412 X:123888831-123888853 TAGGTTTATAAAAATGAGCAAGG + Intronic
1197600860 X:128527549-128527571 CAGTGTTAGAAAGATTATCAGGG + Intergenic
1197659488 X:129154770-129154792 CAGGGTGAAAAAGATGAGCAGGG + Intergenic
1197838219 X:130717900-130717922 TAGAATTATAAAGATAAGCAAGG - Intronic
1198450568 X:136763522-136763544 TAGGGTTATAAAGATGATCACGG + Intronic
1199506348 X:148565874-148565896 TAGGGGTATAAAGATCAACAAGG + Intronic
1199913218 X:152310208-152310230 CAGTGTTAGAAAGATAATCAAGG + Intronic