ID: 1198456416

View in Genome Browser
Species Human (GRCh38)
Location X:136822182-136822204
Sequence CTGAAGCTTTTCAATAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198456416_1198456425 27 Left 1198456416 X:136822182-136822204 CCAGCATTATTGAAAAGCTTCAG No data
Right 1198456425 X:136822232-136822254 CCCAGCACTTTGGAAGGCCAAGG 0: 2871
1: 87078
2: 208817
3: 233449
4: 152400
1198456416_1198456420 -10 Left 1198456416 X:136822182-136822204 CCAGCATTATTGAAAAGCTTCAG No data
Right 1198456420 X:136822195-136822217 AAAGCTTCAGCTGGGCGTGGTGG No data
1198456416_1198456421 17 Left 1198456416 X:136822182-136822204 CCAGCATTATTGAAAAGCTTCAG No data
Right 1198456421 X:136822222-136822244 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1198456416_1198456423 21 Left 1198456416 X:136822182-136822204 CCAGCATTATTGAAAAGCTTCAG No data
Right 1198456423 X:136822226-136822248 TGTAATCCCAGCACTTTGGAAGG 0: 9678
1: 301900
2: 264221
3: 150073
4: 134416
1198456416_1198456427 30 Left 1198456416 X:136822182-136822204 CCAGCATTATTGAAAAGCTTCAG No data
Right 1198456427 X:136822235-136822257 AGCACTTTGGAAGGCCAAGGAGG 0: 1988
1: 60767
2: 149928
3: 159035
4: 96689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198456416 Original CRISPR CTGAAGCTTTTCAATAATGC TGG (reversed) Intergenic
No off target data available for this crispr