ID: 1198458296

View in Genome Browser
Species Human (GRCh38)
Location X:136838756-136838778
Sequence CCCTTTAAGCAGAAGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198458289_1198458296 25 Left 1198458289 X:136838708-136838730 CCTGGAGCAGCCAAATCATTCTA No data
Right 1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG No data
1198458290_1198458296 15 Left 1198458290 X:136838718-136838740 CCAAATCATTCTAATCAAATGCC No data
Right 1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG No data
1198458291_1198458296 -6 Left 1198458291 X:136838739-136838761 CCAAACTACCTGAGTTTCCCTTT No data
Right 1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198458296 Original CRISPR CCCTTTAAGCAGAAGAGGGA TGG Intergenic
No off target data available for this crispr