ID: 1198459249

View in Genome Browser
Species Human (GRCh38)
Location X:136847451-136847473
Sequence CTGTAGCTAAGGAGGTCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198459249_1198459253 19 Left 1198459249 X:136847451-136847473 CCGGAAGACCTCCTTAGCTACAG 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1198459253 X:136847493-136847515 CAGGAACCAGTACAAACTATAGG 0: 1
1: 0
2: 0
3: 6
4: 108
1198459249_1198459254 24 Left 1198459249 X:136847451-136847473 CCGGAAGACCTCCTTAGCTACAG 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1198459254 X:136847498-136847520 ACCAGTACAAACTATAGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 68
1198459249_1198459252 0 Left 1198459249 X:136847451-136847473 CCGGAAGACCTCCTTAGCTACAG 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1198459252 X:136847474-136847496 ATTTTGCTCAAAAAACTTTCAGG 0: 1
1: 0
2: 1
3: 27
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198459249 Original CRISPR CTGTAGCTAAGGAGGTCTTC CGG (reversed) Intergenic
904771992 1:32885984-32886006 CTCCAGCTACTGAGGTCTTCGGG - Intronic
904834484 1:33326093-33326115 GTCTAGCTAAGGAGATTTTCAGG + Intronic
905499003 1:38420960-38420982 CTGCAGCTAATGATGTCCTCAGG - Intergenic
908205392 1:61842842-61842864 CTGTAGCAATGGATGTGTTCTGG + Intronic
910399586 1:86825405-86825427 CTGTAGTTATGGAGGAATTCAGG + Intergenic
911590883 1:99746221-99746243 CTCTAGCTCAGGAAGTCTTAAGG + Intronic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
915319251 1:155047269-155047291 CTGTCTCTGAGGAGGTGTTCAGG - Exonic
918552124 1:185755530-185755552 CAGTGGCTAAGGAGGAGTTCTGG - Intronic
920696404 1:208184338-208184360 CTGTAGCAAAAGAGGAATTCAGG + Intronic
921584114 1:216927894-216927916 CTGTAGCTAAGAAGTTGTTAAGG + Intronic
921765635 1:218970227-218970249 CCTGAGCTAAGGAGTTCTTCAGG - Intergenic
1067296652 10:44978618-44978640 CTGGAGCTGAGGAGGTCTGGGGG + Exonic
1068040574 10:51819132-51819154 CTGTATCTGAGGAGGGCTTCAGG + Intronic
1074128269 10:110548222-110548244 CTGTAGCTAGGAAGGACTGCAGG + Intergenic
1075833106 10:125427969-125427991 CTGTGGCTGAGGCCGTCTTCAGG + Intergenic
1076208100 10:128619143-128619165 CTGCACCAAGGGAGGTCTTCTGG + Intergenic
1076579041 10:131494636-131494658 CTCTATCTACAGAGGTCTTCTGG + Intergenic
1078617924 11:12882100-12882122 CTGTAGCTCAGGAGGGCCACAGG + Intronic
1080113181 11:28592758-28592780 ATGTAGCTGAGGAGGTTTCCAGG - Intergenic
1080257622 11:30308986-30309008 CTGTAGCTTTGAAGGTCTCCTGG - Intergenic
1080898600 11:36466736-36466758 CAGTAGCTAAGCTGGTCTTTTGG - Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1086186801 11:84027166-84027188 TTGTAGCTAAGTAGGGCTTCAGG + Intronic
1086345674 11:85893417-85893439 CTGTAGGGAAGGAGATCTGCAGG - Intronic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1091704094 12:2681978-2682000 CTGGAGCTCAGGAGGGATTCAGG + Intronic
1091713622 12:2760503-2760525 CTGGAGCTCAGGAGGGATTCAGG + Intergenic
1102311854 12:111851314-111851336 CTGTAGATCAGGAGGTCTCAAGG + Intronic
1102360812 12:112286162-112286184 CTTTAGCAAAGGCGCTCTTCAGG + Intronic
1105626529 13:22118072-22118094 CTGTAGCTCAGGCGGACTCCAGG + Intergenic
1109741365 13:66560130-66560152 CTGTTGGTAAGGAAGTGTTCGGG - Intronic
1111190665 13:84802538-84802560 AAGTTGCTATGGAGGTCTTCTGG + Intergenic
1114456513 14:22858166-22858188 ATCTAGCTAAGGAGATTTTCAGG + Intergenic
1117499162 14:56335190-56335212 CTGATGCTAAGGAGGTCCTTCGG + Intergenic
1117744379 14:58853300-58853322 CTCTAGCTAAGGAAATTTTCAGG + Intergenic
1118847977 14:69562463-69562485 CTTTAGCGAATGAAGTCTTCTGG + Intergenic
1134780286 16:16889200-16889222 CTGTAGCTAAGGAGTAGTTGGGG + Intergenic
1135673791 16:24396968-24396990 CTGCATCTGATGAGGTCTTCAGG + Intergenic
1138381195 16:56603840-56603862 CTGTGGCTCAGGATGTCTCCTGG - Intergenic
1138926540 16:61598476-61598498 CTGTAGCTCAGAACGTTTTCTGG + Intergenic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1143503936 17:7353594-7353616 CTGGAGTTGAGCAGGTCTTCGGG - Exonic
1147919200 17:43906135-43906157 CTCTAGGGAAGGAGGACTTCTGG - Intronic
1153572510 18:6487343-6487365 CTGTTGCTAAGGAGATACTCAGG - Intergenic
1154027338 18:10720967-10720989 TTGTAGCCAAGTATGTCTTCAGG - Intronic
1155415482 18:25594503-25594525 CTGTAACTAAGCAGGTCTGGTGG + Intergenic
1156397913 18:36715958-36715980 CTGTAGCTAACGAGGTTTATGGG + Intronic
1156795014 18:41034179-41034201 CTGTAGATAATCAGATCTTCAGG + Intergenic
1157109628 18:44808459-44808481 GAGTAGCTCAGGAAGTCTTCAGG + Intronic
1158893512 18:61893992-61894014 CTGTAACTGGGGAGATCTTCTGG - Intronic
1160000200 18:75011218-75011240 AGGTATCTGAGGAGGTCTTCAGG - Intronic
1167866179 19:52330271-52330293 GTGAAGGTAAGGAGGCCTTCAGG - Intergenic
1168409277 19:56128698-56128720 TTATAGTTAAGGAGGTCTTTGGG - Intergenic
928259904 2:29757171-29757193 CTATAGCTATTGTGGTCTTCTGG - Intronic
929106737 2:38372593-38372615 CTGTGGCAAAGTAGTTCTTCTGG - Intronic
931014878 2:57965227-57965249 CCTTAGCTGTGGAGGTCTTCCGG - Intronic
934553018 2:95273839-95273861 CTGTAGCTGAGCAGGTCATGGGG - Intergenic
934725005 2:96610785-96610807 CTGAAGCCATGGAGGACTTCCGG - Exonic
936898123 2:117452249-117452271 CTGCATCTAATGAGGGCTTCAGG - Intergenic
1171182967 20:23104411-23104433 CGGTACCTAACCAGGTCTTCAGG - Intergenic
1172883687 20:38217568-38217590 CTGAAGCTCAGGAAGTCTCCTGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1175285569 20:57834505-57834527 CTGCAGCTTGTGAGGTCTTCAGG + Intergenic
1178675862 21:34631296-34631318 CTGGAGCTAGGGAGGGCTCCTGG + Intergenic
1179502175 21:41816700-41816722 TCGTAGCCAGGGAGGTCTTCTGG - Intronic
1181977080 22:26737778-26737800 CTGCATCTTAGGGGGTCTTCCGG - Intergenic
950321419 3:12058130-12058152 CTGTAGATAAGTAGGCCATCTGG + Intronic
951619696 3:24587549-24587571 ATATAGCTAAGGATGTCCTCTGG - Intergenic
952508118 3:34026283-34026305 CTGTAGCTAATGATTTCTTTTGG - Intergenic
953728957 3:45428625-45428647 ATGTAGGTAAGGAGTTCATCTGG - Intronic
956720271 3:72111189-72111211 CTCTGGCAAAGGAGGTTTTCTGG - Intergenic
960123247 3:113968958-113968980 CTGTTTCTAATGAGGACTTCAGG + Intronic
964537999 3:157746873-157746895 CTCTAGCTCAGGAGGTCATGAGG - Intergenic
966717639 3:183029833-183029855 CTGAATCTGAGGAGGTCCTCTGG + Intronic
968544845 4:1193533-1193555 CTGTTGCTGGGGAGGTGTTCTGG - Intronic
969883408 4:10194675-10194697 CTGTAGCTAGGGTGGCCTCCAGG + Intergenic
971193293 4:24447808-24447830 CTGTGGGAAAGGATGTCTTCTGG - Intergenic
972960518 4:44447777-44447799 CGCTGGCCAAGGAGGTCTTCGGG - Exonic
973734544 4:53857499-53857521 ATGTAGCCAAGGAGGTCATGAGG - Intronic
976514459 4:85949023-85949045 CCCTAGCTAAGGAGGTTTTCAGG - Intronic
977443348 4:97098433-97098455 CTGACGCTAAGGAGGACTCCAGG - Intergenic
986316442 5:6591858-6591880 GAGCAGATAAGGAGGTCTTCAGG + Intergenic
992322899 5:75631522-75631544 CTGTGCCTAAGGAGTTATTCAGG + Intronic
992868985 5:80987066-80987088 CTGTAGAAAAGGAGCTCATCTGG - Intronic
997118466 5:131150632-131150654 CTATAGCTTATGAGGTGTTCTGG + Intergenic
1001313655 5:170628122-170628144 ATGCAGCCAAAGAGGTCTTCAGG + Intronic
1004269063 6:14177685-14177707 CTCTAGCTAAGGATTTCTTGAGG + Intergenic
1004821224 6:19369976-19369998 CTGTCTCTAAGGAGGGGTTCAGG + Intergenic
1005273170 6:24187611-24187633 CTGGCACTATGGAGGTCTTCTGG + Intronic
1006830832 6:36967293-36967315 CTGTAGAGAAGGAGGGCCTCGGG - Intergenic
1007402441 6:41611160-41611182 CTGTAGCTCAGTAGGGCTCCAGG - Intergenic
1008444308 6:51570633-51570655 ATGTTGCCAAGGGGGTCTTCTGG - Intergenic
1011424528 6:87212300-87212322 CTGTTGTTTAGGAGGTCTTGTGG + Intronic
1018958625 6:168430966-168430988 CTGCAGCTAAGGAGGCCTCCAGG + Intergenic
1019748156 7:2712245-2712267 CCTTAGGTAAGGAGGTCTCCTGG + Intronic
1022650259 7:32267487-32267509 CTGGGGCCAAGGAGGGCTTCTGG + Intronic
1024142957 7:46480683-46480705 CTGCAGCTGAGGAGGTGTTAGGG - Intergenic
1035359157 7:158298899-158298921 CTGTGGCTCAGGAGGTATTTGGG - Intronic
1041755450 8:61308617-61308639 CTGGAAATATGGAGGTCTTCTGG - Intronic
1042043879 8:64625420-64625442 CTGTGACTAAGGAGATCTCCGGG + Intronic
1059561417 9:115338459-115338481 CTGTAGCAAACGAGGATTTCTGG - Intronic
1061041746 9:128144705-128144727 CTGAAGCCAGGGATGTCTTCAGG + Intergenic
1190630529 X:52381283-52381305 CTGAAGCTCAGGAAGTCTGCTGG - Intergenic
1195621964 X:106965994-106966016 ATTTAGCTGAGGAGATCTTCAGG + Intronic
1198459249 X:136847451-136847473 CTGTAGCTAAGGAGGTCTTCCGG - Intergenic