ID: 1198469027

View in Genome Browser
Species Human (GRCh38)
Location X:136928958-136928980
Sequence CCTGATCAGCAGTTATCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198469021_1198469027 11 Left 1198469021 X:136928924-136928946 CCATGAGGCCACCAAAACTGAGG No data
Right 1198469027 X:136928958-136928980 CCTGATCAGCAGTTATCCTCAGG No data
1198469020_1198469027 12 Left 1198469020 X:136928923-136928945 CCCATGAGGCCACCAAAACTGAG No data
Right 1198469027 X:136928958-136928980 CCTGATCAGCAGTTATCCTCAGG No data
1198469018_1198469027 21 Left 1198469018 X:136928914-136928936 CCTCCTCAACCCATGAGGCCACC No data
Right 1198469027 X:136928958-136928980 CCTGATCAGCAGTTATCCTCAGG No data
1198469019_1198469027 18 Left 1198469019 X:136928917-136928939 CCTCAACCCATGAGGCCACCAAA No data
Right 1198469027 X:136928958-136928980 CCTGATCAGCAGTTATCCTCAGG No data
1198469023_1198469027 3 Left 1198469023 X:136928932-136928954 CCACCAAAACTGAGGTCCACGTT No data
Right 1198469027 X:136928958-136928980 CCTGATCAGCAGTTATCCTCAGG No data
1198469024_1198469027 0 Left 1198469024 X:136928935-136928957 CCAAAACTGAGGTCCACGTTTGT No data
Right 1198469027 X:136928958-136928980 CCTGATCAGCAGTTATCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198469027 Original CRISPR CCTGATCAGCAGTTATCCTC AGG Intergenic
No off target data available for this crispr