ID: 1198469416

View in Genome Browser
Species Human (GRCh38)
Location X:136932367-136932389
Sequence GCCTCTGGAGTGACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 4, 1: 7, 2: 16, 3: 44, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198469414_1198469416 -5 Left 1198469414 X:136932349-136932371 CCATGCATAGACTGGTCAGCCTC 0: 3
1: 6
2: 25
3: 41
4: 140
Right 1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG 0: 4
1: 7
2: 16
3: 44
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198469416 Original CRISPR GCCTCTGGAGTGACCAGAGC AGG Intergenic
900326329 1:2110321-2110343 GCCCCGGGCGTGATCAGAGCAGG + Intronic
900562039 1:3312012-3312034 GGCTCTGGAGTGTCCAGCCCAGG + Intronic
900647242 1:3714506-3714528 CTCTCTGCAGTGAGCAGAGCAGG + Intronic
900859404 1:5217448-5217470 GCCTCTGTGGAGAGCAGAGCAGG - Intergenic
901752073 1:11416474-11416496 ACCTCTGTAGTGACCAGTCCAGG + Intergenic
901785115 1:11619463-11619485 GACCCTGGAGTGATCAGGGCAGG - Intergenic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
903141879 1:21344198-21344220 GCCCCTGCTGTGCCCAGAGCTGG - Intronic
904174615 1:28617837-28617859 GCCTTTTGAGAGACCAAAGCAGG - Intronic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905444560 1:38017870-38017892 GCACCTGGAGTAACCAGAGAAGG - Intronic
905462414 1:38130310-38130332 GCCCCTGGAGGGCCCAGAACAGG + Intergenic
905629561 1:39511108-39511130 GGCTCTGGAGGGGGCAGAGCTGG - Intronic
905668198 1:39775082-39775104 GGCTCTGGAGGGGGCAGAGCTGG + Intronic
906201473 1:43963298-43963320 GCCTCAGGAATGATCAGAACTGG + Intronic
907249057 1:53125836-53125858 GCTTCTGGTGTAAACAGAGCTGG - Intronic
907326344 1:53640956-53640978 GCCTCTGGAGGGAACAGAACCGG + Intronic
908174347 1:61539615-61539637 GCCTCTGGAGTCACCCAGGCTGG + Intergenic
909531081 1:76682336-76682358 GTCCCTAGAGTGACCAGAGGTGG - Intergenic
910727805 1:90356910-90356932 AGCTTTGGAGTGACCAGATCTGG + Intergenic
915286929 1:154859058-154859080 GCCTTTGGAGGGCTCAGAGCTGG - Intronic
916943902 1:169704718-169704740 GCCTTTGGAGGCCCCAGAGCTGG - Exonic
921045186 1:211471483-211471505 TCCTCTGGAGTGTCCAGACCTGG - Intergenic
921569924 1:216765569-216765591 GCCTTTGGAGAGAGTAGAGCAGG - Intronic
1062902350 10:1156011-1156033 GCCTCTGCAGAAACCATAGCAGG - Intergenic
1063139416 10:3243149-3243171 CCCCCTGGAGTGCCCAGTGCTGG - Intergenic
1063141021 10:3256758-3256780 GCCTGTGGAGAGACCAGGCCAGG + Intergenic
1063702715 10:8401117-8401139 CCCTGTGGAGTGATCAGAGAAGG + Intergenic
1064735103 10:18374218-18374240 GCCTCTGAAGTTTCCAGAACAGG + Intronic
1065214446 10:23437307-23437329 GCGGCTGGAGTGACCTGAGCTGG + Intergenic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1068828014 10:61461518-61461540 GTCTCTGGAATGACCAGGGAAGG + Intergenic
1071186736 10:83054764-83054786 GCCTATGGCATGACCAAAGCAGG - Intergenic
1072059933 10:91799418-91799440 GTTTCTGGAGTGACTAGAACGGG + Intronic
1072656075 10:97331514-97331536 GCCTCGGGAGTGTGCTGAGCAGG + Intergenic
1073069753 10:100785839-100785861 GCCTCTGGAGTGAGCACAGCAGG + Intronic
1073114374 10:101083014-101083036 TCCTCTGGACTGAGGAGAGCTGG + Intergenic
1073255273 10:102146920-102146942 ACCTCTGGAATGACTAGGGCAGG - Exonic
1074498142 10:113997714-113997736 GCCTCTGAAGTCAGCAGGGCAGG - Intergenic
1074829718 10:117240407-117240429 GCCTCTGGGGCCACCTGAGCAGG - Intergenic
1075726373 10:124612902-124612924 GCCCCTGGGGAGCCCAGAGCAGG + Intronic
1076856259 10:133116793-133116815 GACTCGGAACTGACCAGAGCTGG - Intronic
1077250509 11:1558693-1558715 GCCCCTGGAAGGACCACAGCAGG - Intronic
1077289822 11:1783829-1783851 GCCGCTGGTGAGAGCAGAGCTGG + Intergenic
1080189263 11:29525188-29525210 GCTCCTGGGGTGACTAGAGCAGG - Intergenic
1081737090 11:45411634-45411656 GCCCCAGGAGTGAGCAAAGCAGG - Intergenic
1082910325 11:58365965-58365987 GTCCATGGAGTGACCAGAGCTGG + Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1083876705 11:65527935-65527957 GTGACTGGAGTAACCAGAGCTGG - Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1084581495 11:70026777-70026799 GCCTTTGGAGAGTCGAGAGCTGG - Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085046064 11:73354377-73354399 GCCTCTGGACAGAACAGGGCAGG - Intronic
1085249989 11:75136734-75136756 TCCTCTGGATTGACCAGGCCTGG + Intronic
1085546291 11:77321226-77321248 TTCTCTGGTGTGATCAGAGCTGG + Intergenic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1085803807 11:79616103-79616125 GGCTCTGGAGTGAGAAGAGCTGG - Intergenic
1089577992 11:119460272-119460294 CCTTCGGGAGTGACCAGACCTGG - Intergenic
1089862667 11:121604055-121604077 ACCTCTGGAATGACCAGTGGTGG - Intronic
1090030768 11:123204213-123204235 GCCTCTGAAGTGAGCAGAGATGG + Intergenic
1090619258 11:128547122-128547144 CCCTTGGGACTGACCAGAGCAGG + Intronic
1091324069 11:134671063-134671085 GCCTTTGCAGTGACCTGAGCGGG + Intergenic
1091999741 12:5022441-5022463 GCTACTGGAGTGACCACAGAAGG - Intergenic
1094407163 12:30128583-30128605 GCCTCTGGAGTCAGAAGTGCTGG - Intergenic
1095421354 12:42027732-42027754 GGCTCTGCAGTGACCGGAGCAGG - Intergenic
1096042059 12:48526194-48526216 GCTTCTGGAGATATCAGAGCAGG - Exonic
1096092783 12:48914478-48914500 GCCTCTGCAGGGCCAAGAGCTGG - Exonic
1096138895 12:49225945-49225967 GCCACGGGCGTGGCCAGAGCTGG + Intronic
1098276387 12:68816074-68816096 GCCTCTGAGGTCACCAGAGGAGG - Intronic
1101286321 12:103317006-103317028 GCCACTGTGGTGACTAGAGCTGG - Intronic
1104017538 12:124970955-124970977 GCCTCTGGGATCAGCAGAGCAGG - Intronic
1104981991 12:132577293-132577315 GCCTCTGGTGGGGCCAGAACAGG - Intronic
1105418101 13:20230925-20230947 GCCACTGCAGTGACTAAAGCTGG - Intronic
1105979211 13:25501420-25501442 GGCTCTGGAATGATCAGGGCAGG + Intronic
1106140251 13:27005817-27005839 GGCTCTGGGGTGATCAGGGCAGG + Intergenic
1106914720 13:34500135-34500157 ACAGCAGGAGTGACCAGAGCTGG - Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1113254715 13:108495149-108495171 GGCTCTTGAATGACCAGAGAGGG + Intergenic
1113722155 13:112567141-112567163 GCCTCTGGGGTGTCCCCAGCAGG - Intronic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1118056490 14:62084406-62084428 GCCTCTGGAAGAACCAGAGCTGG - Intronic
1118391769 14:65301966-65301988 GCCTCTGTAGCGACCAGCCCAGG + Intergenic
1118492645 14:66276609-66276631 GTCTCTGGAGAGAGCAGATCTGG - Intergenic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1121429038 14:93873970-93873992 GCCTCAGGAGGGGGCAGAGCTGG - Intergenic
1121600684 14:95200642-95200664 GCCACTGGAGTGATCAGTGAAGG - Intronic
1122100190 14:99402319-99402341 GGCTCTGGAGTTAACAGAGGTGG + Intronic
1122698119 14:103567835-103567857 AACGCTGGAGTGACCACAGCAGG - Intronic
1125520967 15:40347653-40347675 GCCTCTGGAGTGGCCTTAGGTGG + Intergenic
1125577906 15:40767630-40767652 GCCGCTGGAGTGCCCAGCTCCGG - Exonic
1126894428 15:53243036-53243058 GCCTCTGGAGACCCCAAAGCAGG + Intergenic
1127639911 15:60906679-60906701 GCCCCTGGATTGGCCAGGGCTGG - Intronic
1128335559 15:66783715-66783737 GCTTCTGGGCTGACCACAGCTGG + Intergenic
1128600645 15:68992812-68992834 GCTTCTGGGGTGACTAGAGCAGG + Intronic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1129192982 15:73948126-73948148 GCCTCTGGCATTACCACAGCTGG - Intronic
1129243905 15:74268449-74268471 GGCTCTGGAGGTACCAGGGCTGG + Exonic
1129667400 15:77587289-77587311 GCACCTGTAGTTACCAGAGCAGG - Intergenic
1131071855 15:89471103-89471125 CCTGCTGGAGTGCCCAGAGCAGG + Intergenic
1131458164 15:92599232-92599254 GACTCTGCAGTGACTTGAGCCGG - Intergenic
1132234036 15:100205912-100205934 CCCTCTGGAGGGGCCAGACCTGG - Intronic
1132617450 16:848781-848803 GTCTCTGGAATGTCCAGAACAGG - Intergenic
1132666034 16:1081755-1081777 GCCTCTTGAGTCACCAAAGAGGG + Intergenic
1133222428 16:4324437-4324459 TCCTGGGGAGTGACCACAGCTGG - Intronic
1133279066 16:4655031-4655053 GCATTTGGAGTGACCAGGGCAGG + Intronic
1133678270 16:8096368-8096390 GCTTCAGCTGTGACCAGAGCTGG - Intergenic
1134204226 16:12224006-12224028 GGCTCTGGAGTGAGGAGACCTGG - Intronic
1134809532 16:17155536-17155558 CCCTCCCAAGTGACCAGAGCTGG - Intronic
1135797217 16:25457122-25457144 GACTCTGGGGTGATCAGGGCAGG + Intergenic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1137628262 16:49923061-49923083 GGCTCTGGGGTGAGCAGATCTGG + Intergenic
1138351665 16:56349218-56349240 GCCACTAGAGTGACCTGAGCTGG - Intronic
1138352277 16:56352387-56352409 GCCCCTAGAGGGACCAGGGCTGG - Intronic
1138607504 16:58098415-58098437 GCACCTGGAGTGGCCAGAGGAGG - Intergenic
1139853495 16:69964031-69964053 GACCCTGGAGAGACCAGAGGGGG + Exonic
1139877718 16:70159754-70159776 GCCTCTTGAGTGAACAGGGGAGG + Exonic
1139882466 16:70186940-70186962 GACCCTGGAGAGACCAGAGGGGG + Exonic
1140370043 16:74408564-74408586 GACCCTGGAGAGACCAGAGGGGG - Intronic
1141141205 16:81497903-81497925 GCCTCTGGGGGGACCACAGCTGG - Intronic
1141702812 16:85650255-85650277 GCCTCTGGAGGCAGCGGAGCTGG - Intronic
1141731854 16:85828316-85828338 GCCTCGGGAGTGACCTGCACAGG + Intergenic
1141812923 16:86388170-86388192 CCCACTGCAGTGACCACAGCCGG + Intergenic
1142286890 16:89175157-89175179 GCCTCTGGCTTGACCACACCCGG + Intronic
1145269411 17:21396730-21396752 ACCCCTGGAGTCACCAGAGCCGG + Intronic
1145902125 17:28496086-28496108 ACCTCAGGAATGACCAGAACAGG - Intronic
1148446253 17:47739368-47739390 GCCTCCCGAGTCACCCGAGCGGG - Intronic
1148853780 17:50567563-50567585 GACTCTGTAGGGCCCAGAGCAGG - Intronic
1149013274 17:51880094-51880116 GGCTCTGGGGTGATTAGAGCAGG - Intronic
1150217003 17:63476679-63476701 GCCTCCGGAGTGACAAGGCCGGG - Intergenic
1150461731 17:65359290-65359312 GGCTCTGGAGTGACTGGAGAAGG + Intergenic
1151462285 17:74261536-74261558 GCCTGTTGAGGGACCAGAGTTGG + Exonic
1152061080 17:78075705-78075727 GCCACATGAGTGACCACAGCTGG + Intronic
1154108590 18:11546994-11547016 GCCTCCTGATTGGCCAGAGCAGG + Intergenic
1156039744 18:32807170-32807192 GACTCTGGAGTCAGAAGAGCTGG + Intergenic
1157681215 18:49608540-49608562 GCCTCTGCAGTGTCCAGGCCAGG - Intergenic
1158960642 18:62584999-62585021 GCCTCTGGACTGAGGAGGGCTGG + Intronic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1160810955 19:1012751-1012773 GCCTCTGCAGTGCACAGGGCAGG - Intronic
1161260604 19:3335781-3335803 GCCACCGGTGTGACCAGACCAGG + Intergenic
1162817799 19:13207163-13207185 GACTCTGGAGAGGCCAGGGCTGG - Exonic
1163255033 19:16150935-16150957 GCCTCTGTATTGAACAGTGCAGG + Intronic
1163739412 19:19001847-19001869 ACCCCTGGAGTGAGCAGAGACGG + Intronic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286101 19:23819219-23819241 GCTTCTGGGGTGACTAGAACAGG + Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1165358592 19:35319400-35319422 GGCTCTGGAGTGGCCAGTGCTGG - Intronic
1166423314 19:42654798-42654820 AGCTCTGGAGGGAGCAGAGCAGG + Intronic
1166905998 19:46108781-46108803 CTGTCTGGAGTGACCAGCGCTGG + Intergenic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167954686 19:53055310-53055332 TCCTCTGGTATGAGCAGAGCAGG + Intergenic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
924961946 2:43640-43662 GGGTCTGGAGGGATCAGAGCAGG + Intronic
925177291 2:1794541-1794563 GCCTGTGGGGTGACCAAGGCAGG + Intronic
926120590 2:10239400-10239422 GCCTCTGGAGGGACCCAAGGAGG - Intergenic
927678365 2:25123532-25123554 GCCTCTGGTGAGGCCAGAGTGGG + Intronic
927690910 2:25207473-25207495 GTCTGTGGAGTGACCTCAGCTGG - Intergenic
927886395 2:26721271-26721293 GCCTCTTCAGTGCCCAGAGAAGG + Intronic
929438356 2:41946264-41946286 ACCTCTGGAGTTTCCAGACCTGG + Intronic
931431851 2:62214798-62214820 GCATCTGGAGTGACAGGACCAGG - Intronic
932201112 2:69829446-69829468 GCCTCTGTAGTGGCAAGACCTGG - Intergenic
934576776 2:95406922-95406944 GGCTCTGTAGAGACCAGAGCAGG - Exonic
934638995 2:96015090-96015112 GGCTCTGTAGAGACCAGAGCAGG - Intergenic
934794653 2:97090322-97090344 GGCTCTGTAGAGACCAGAGCAGG + Exonic
936056185 2:109264007-109264029 GCTTCTGGAGTGTCCTGACCAGG - Intronic
937793905 2:125994521-125994543 GCATCTGGACTGCCCAGGGCTGG - Intergenic
939871047 2:147526324-147526346 GACTATGGGGTGACCAGGGCAGG - Intergenic
940865323 2:158812140-158812162 GCTTTTGGGGTGCCCAGAGCAGG - Intronic
943793503 2:191963087-191963109 GCCTCTTGGGAGTCCAGAGCTGG + Intronic
946713860 2:222533215-222533237 GCCTCAGGAGGGACCAGAAGAGG + Intronic
947502413 2:230680992-230681014 GCCTCTGGAGTGAGTAGATTGGG + Intergenic
948021703 2:234738604-234738626 GCCTCTGAACTGAACACAGCTGG + Intergenic
1169812686 20:9624670-9624692 GGCTCTGGAGTCTCCTGAGCTGG + Intronic
1171003201 20:21435747-21435769 GTCTCCGGAGAGAGCAGAGCAGG + Intergenic
1171155187 20:22865492-22865514 GCCTCTTGGGTCACCAGAGTCGG - Intergenic
1172113631 20:32561497-32561519 GCCTCTGGGGGGCCCAGAGCAGG + Intronic
1172301825 20:33855769-33855791 GCTTCTGGGTTCACCAGAGCTGG - Intergenic
1172617828 20:36300833-36300855 GGCTCTGGAGTGAACAGGCCTGG - Intergenic
1173547560 20:43910646-43910668 GGCTCTGGAGTAATTAGAGCAGG - Intergenic
1173954267 20:47018575-47018597 GCCACAGGAGGGGCCAGAGCTGG + Intronic
1176170598 20:63694767-63694789 GGGTCTGGAGTGCCCAGAGCAGG + Exonic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179511980 21:41879272-41879294 GCCTTTGGAATGTGCAGAGCGGG + Exonic
1180169634 21:46051083-46051105 GCCTCTCGAGAACCCAGAGCCGG - Intergenic
1180990164 22:19930905-19930927 GCCACTGGGGTGACCCCAGCAGG + Intronic
1182583968 22:31332553-31332575 GCTTCTGGAGTGCCAAGTGCAGG - Intronic
1184285194 22:43466694-43466716 GCCCCTGGGGTGATCAGGGCAGG - Intronic
1184943321 22:47784142-47784164 GCGTGGGGAGTGACCAGGGCCGG - Intergenic
1185148143 22:49150268-49150290 GACCCAGGAGTGAACAGAGCAGG - Intergenic
950432753 3:12960418-12960440 GCCACTGGAGTGCGCACAGCTGG + Intronic
950668799 3:14513050-14513072 GACTCTGGTCTGACTAGAGCAGG - Intronic
952743760 3:36759384-36759406 GCCACTGTAGTCACCAGTGCAGG - Intergenic
952967563 3:38630713-38630735 GCCTCTGCTGTGACAACAGCTGG - Intronic
953290241 3:41653205-41653227 GGCTCTGGAGTGATCAGGGCAGG - Intronic
953582270 3:44167729-44167751 GCTTCTGGAGAGAACAGGGCTGG - Intergenic
954139298 3:48596614-48596636 GACTCTGGTGTGGCCAGAGCTGG + Intergenic
955696240 3:61640313-61640335 CCCTCTGGAGAGATCAGAGTAGG + Intronic
955853491 3:63247520-63247542 GCCTATGGAGTGTGCTGAGCTGG + Intronic
958711743 3:97725091-97725113 GCCTCTGGATTGAGCAATGCTGG - Intronic
959389621 3:105758724-105758746 GCCACTGGCTTGCCCAGAGCCGG - Intronic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
960634890 3:119774945-119774967 GGTTCTGGAGGGAGCAGAGCAGG + Intergenic
960742150 3:120846216-120846238 AGCTCTGGAGTGAGCAGAGCTGG + Intergenic
961033991 3:123629623-123629645 GACTCTGGAGAGACAAGAGCAGG + Exonic
961072599 3:123948717-123948739 GCCGCTGAAGTGACCAGACTGGG + Exonic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
965923272 3:173945371-173945393 GCCTCTGGAGTGTGCAGAGCTGG + Intronic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
970356316 4:15256707-15256729 GGCTTTTGAGTGACCAGACCTGG + Intergenic
972105695 4:35482975-35482997 GACTCTGGAGTCACCAGACCAGG + Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
972739551 4:41877522-41877544 CCAGCTGGAGTGACCAGACCAGG + Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
975926012 4:79454541-79454563 AACTCTGGAGTTAGCAGAGCTGG + Intergenic
976517979 4:85993704-85993726 GCCACTGGAATGGGCAGAGCAGG - Intronic
977557855 4:98503072-98503094 GGCTCTGGAGTGATCTCAGCAGG + Intronic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
982630186 4:157821893-157821915 TCCTCTAGTGTGGCCAGAGCAGG - Intergenic
988681224 5:33486029-33486051 GCCTCTGCAGGGAACAGAGGTGG - Intergenic
989327278 5:40213341-40213363 GCATCTGGAGAGAGAAGAGCTGG + Intergenic
991487060 5:67148462-67148484 GCCTCTGCATTCACCAGACCAGG + Intronic
991537446 5:67686456-67686478 GCCACAGAAGTGACCTGAGCAGG - Intergenic
996110125 5:119555674-119555696 GTGTGTGGAGTGAGCAGAGCAGG + Intronic
998375547 5:141688229-141688251 GCTTTGGGAGTGACCAGAGGGGG + Intergenic
1000013156 5:157252764-157252786 GCCTCTGGAGGGTCCTGGGCTGG - Exonic
1001264119 5:170260056-170260078 CCCTCAGGAGTGTCCTGAGCAGG - Intronic
1001774038 5:174315460-174315482 GCCACTGGAGAGCTCAGAGCAGG + Intergenic
1003317673 6:5026694-5026716 GCCTATGGAGTCACCAGGGCAGG - Intergenic
1003632992 6:7804977-7804999 CCCTCTGGTGTGACCTGAGAGGG - Intronic
1003986029 6:11436168-11436190 GCCCCTGGAGTGAGCAGAAGGGG - Intergenic
1004478897 6:16000261-16000283 TACTCTGGAGTGACCAGAGAAGG - Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1011117449 6:83909210-83909232 ACCTCTGGAGTGGCTAGACCAGG - Intronic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1013411531 6:109888148-109888170 GCTTCTGGGGTGACTGGAGCAGG + Intergenic
1014747867 6:125221009-125221031 GCCTGTGGAGAGGCCAAAGCAGG - Intronic
1015086037 6:129293058-129293080 GCCTCTGGGATTACCGGAGCTGG - Intronic
1015162553 6:130169625-130169647 GGCCCTGGATTGACCATAGCAGG + Intronic
1018116034 6:160586280-160586302 TTCTCTGGGGGGACCAGAGCTGG - Intronic
1018269132 6:162056886-162056908 GCCTCTCGAGTGACCACTGGGGG + Intronic
1018341607 6:162856880-162856902 GCATCTGGAGTGACTCCAGCGGG + Intronic
1019164326 6:170088199-170088221 GCCGCTGGTGGGAGCAGAGCTGG + Intergenic
1019166750 6:170102292-170102314 TCCTCTGGGGTGACCGCAGCAGG + Intergenic
1019307461 7:342720-342742 GCCTCTGGGGTGGCCAGATGAGG + Intergenic
1019372707 7:671284-671306 GCCTCTGGAGGGAACAGCTCAGG + Intronic
1019706754 7:2500440-2500462 ACCACTGGAGTTCCCAGAGCGGG - Intergenic
1020777615 7:12474152-12474174 GCCTCTGGAGAAACCAGCGAGGG - Intergenic
1022088082 7:27088160-27088182 GCCTCTGGATGGACCTGCGCCGG - Intergenic
1022896778 7:34758001-34758023 TCCTCTGGAATGACCATAACTGG + Intronic
1025823535 7:64993186-64993208 GCTTCTGGGGTGACTAGAGCAGG + Exonic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1029161366 7:98554716-98554738 GCCACGGGTGTGAGCAGAGCAGG - Intergenic
1030084314 7:105803874-105803896 GCCTCTCCAGTGATCAGAGATGG + Intronic
1030180619 7:106704652-106704674 ACCTCTGCAGTAACCAGTGCTGG - Intergenic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033109153 7:138559552-138559574 GCTTCTGGGGTGACTAGAGCCGG + Intronic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1035412573 7:158656910-158656932 GCTTCTTCAGTGTCCAGAGCTGG - Intronic
1035982726 8:4391490-4391512 CCCTCTGCTGTGACCAGTGCAGG + Intronic
1036044738 8:5127134-5127156 GCCTCTGGGTTGAACATAGCTGG - Intergenic
1038491468 8:27975036-27975058 GCCACTGGAATGACCAAGGCAGG + Intronic
1039572931 8:38601618-38601640 GGCTTTGGAGTGACGAGGGCTGG + Intergenic
1039889170 8:41672705-41672727 TCCTCAGCAGTGACCAGAGAAGG + Exonic
1040533191 8:48282603-48282625 GCCTCTGGGGAGCCCAGTGCAGG - Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1041011631 8:53549495-53549517 TGGTCTGGGGTGACCAGAGCAGG - Intergenic
1041049025 8:53915214-53915236 ACCTCTGGAGAGGCCAAAGCTGG - Intronic
1041527368 8:58822483-58822505 ACAGCAGGAGTGACCAGAGCCGG + Intronic
1042236109 8:66614165-66614187 CCCTCTGGAGAGACCAGGGAGGG + Intronic
1044340868 8:91044893-91044915 GCCTCTGGGGTCAAAAGAGCTGG - Intergenic
1047220071 8:122911792-122911814 TCATCTGGAATGATCAGAGCAGG + Intronic
1047401675 8:124553503-124553525 ACCCCTGGAGTGACCATAGCAGG + Exonic
1048194950 8:132324808-132324830 GGCTCTGGAGCCAGCAGAGCTGG - Intronic
1048427867 8:134339243-134339265 GCCTCAGGTTTGACCTGAGCTGG - Intergenic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1049439532 8:142602818-142602840 GATTCTGGAGGGACCAGAGGGGG + Intergenic
1051249086 9:15141052-15141074 GCCAATGGAGTGACTTGAGCAGG - Intergenic
1054798972 9:69327706-69327728 TCCTCTGGTGTGCCCAGACCTGG - Intronic
1056993161 9:91429522-91429544 GTCTCTGGAGTGACAAAAGTTGG - Intergenic
1057855252 9:98596498-98596520 TCCTCAGGAGGGACCAGAGAGGG - Intronic
1058987771 9:110224692-110224714 GGCTCTGGGGTGACCAGGGTAGG + Intergenic
1060819248 9:126651980-126652002 GCCTCGGTAGTGGCCAGAGATGG + Intronic
1060976978 9:127770642-127770664 GCATCTGGAGTGTCCCGAGGAGG - Intronic
1061037111 9:128120116-128120138 GCCTCTGGAGGGTCCCTAGCAGG + Intergenic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061191299 9:129084245-129084267 ACCTCTGGAGTCACCAGGCCGGG + Intronic
1061263779 9:129494204-129494226 GCAGCTGGGGTGGCCAGAGCTGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1061990381 9:134155424-134155446 GCCTCTGGTGGGGACAGAGCTGG + Intronic
1062174777 9:135155248-135155270 TCCTCTGGAGTCACCACAGTGGG - Intergenic
1062600523 9:137316884-137316906 TCCCCTGGAAGGACCAGAGCAGG - Intronic
1062678043 9:137759875-137759897 GCCTGTGGAGTGTGCTGAGCGGG + Intronic
1062710295 9:137971756-137971778 GCCTGGGGTGTGTCCAGAGCTGG + Intronic
1189124609 X:38433171-38433193 GCCTCTTCAGAGACCAGAGAAGG - Intronic
1190343240 X:49313849-49313871 GCCTCTGGTGTGGTCAGAGCAGG - Intronic
1190862769 X:54359342-54359364 GGCTCTGGAGTGAGCACACCTGG - Intergenic
1194090806 X:89580687-89580709 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1194379246 X:93174654-93174676 GCCTTTGGAGGGCCAAGAGCAGG + Intergenic
1195042808 X:101029800-101029822 ACATCTGGAGTGACCACAGAGGG + Intronic
1196867399 X:120082805-120082827 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic
1196875700 X:120153477-120153499 GCCTCCGGTGTGGTCAGAGCAGG - Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1198576384 X:138014476-138014498 GGCTCTGGTGTGACCACAGGAGG - Intergenic
1199754637 X:150852674-150852696 TCATCTGAGGTGACCAGAGCAGG - Intronic
1200279106 X:154761870-154761892 GCCTGTGGACTGACTAGATCTGG + Intergenic
1200443458 Y:3236747-3236769 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201860304 Y:18590490-18590512 GCTTTTGGAGGGACCAGAGCAGG + Intergenic
1201873019 Y:18729891-18729913 GCTTTTGGAGGGACCAGAGCAGG - Intergenic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1202051952 Y:20790811-20790833 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic