ID: 1198480221

View in Genome Browser
Species Human (GRCh38)
Location X:137033922-137033944
Sequence GCTGCGGGCGCGGCAGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198480203_1198480221 30 Left 1198480203 X:137033869-137033891 CCCGGCCGCCTCTCGGGGCTCGG No data
Right 1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG No data
1198480205_1198480221 29 Left 1198480205 X:137033870-137033892 CCGGCCGCCTCTCGGGGCTCGGG No data
Right 1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG No data
1198480209_1198480221 22 Left 1198480209 X:137033877-137033899 CCTCTCGGGGCTCGGGCGGCTGC No data
Right 1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG No data
1198480208_1198480221 25 Left 1198480208 X:137033874-137033896 CCGCCTCTCGGGGCTCGGGCGGC No data
Right 1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198480221 Original CRISPR GCTGCGGGCGCGGCAGGAGC GGG Intergenic
No off target data available for this crispr