ID: 1198482318

View in Genome Browser
Species Human (GRCh38)
Location X:137052430-137052452
Sequence GGGGTGGCCCGCGGGCGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198482311_1198482318 -9 Left 1198482311 X:137052416-137052438 CCGTGGGCCGCCCAGGGGTGGCC No data
Right 1198482318 X:137052430-137052452 GGGGTGGCCCGCGGGCGGTGCGG No data
1198482304_1198482318 -3 Left 1198482304 X:137052410-137052432 CCCTCCCCGTGGGCCGCCCAGGG No data
Right 1198482318 X:137052430-137052452 GGGGTGGCCCGCGGGCGGTGCGG No data
1198482298_1198482318 13 Left 1198482298 X:137052394-137052416 CCCGAGAAGTGCAAGCCCCTCCC No data
Right 1198482318 X:137052430-137052452 GGGGTGGCCCGCGGGCGGTGCGG No data
1198482302_1198482318 -2 Left 1198482302 X:137052409-137052431 CCCCTCCCCGTGGGCCGCCCAGG No data
Right 1198482318 X:137052430-137052452 GGGGTGGCCCGCGGGCGGTGCGG No data
1198482306_1198482318 -4 Left 1198482306 X:137052411-137052433 CCTCCCCGTGGGCCGCCCAGGGG No data
Right 1198482318 X:137052430-137052452 GGGGTGGCCCGCGGGCGGTGCGG No data
1198482299_1198482318 12 Left 1198482299 X:137052395-137052417 CCGAGAAGTGCAAGCCCCTCCCC No data
Right 1198482318 X:137052430-137052452 GGGGTGGCCCGCGGGCGGTGCGG No data
1198482310_1198482318 -8 Left 1198482310 X:137052415-137052437 CCCGTGGGCCGCCCAGGGGTGGC No data
Right 1198482318 X:137052430-137052452 GGGGTGGCCCGCGGGCGGTGCGG No data
1198482308_1198482318 -7 Left 1198482308 X:137052414-137052436 CCCCGTGGGCCGCCCAGGGGTGG No data
Right 1198482318 X:137052430-137052452 GGGGTGGCCCGCGGGCGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198482318 Original CRISPR GGGGTGGCCCGCGGGCGGTG CGG Intergenic
No off target data available for this crispr